Description :
From Genome Similarity Track
Location :
Scaffold_353:22764- 27574
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_353-snap-gene-0.14Heat shock protein 40/ DnaJ domain containing protein
Pytve_DAOMBR484maker-pve_contig_353-snap-gene-0.22Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_353-snap-gene-0.15ALY protein
Pytve_DAOMBR484maker-pve_contig_353-fgenesh-gene-0.53-oxo-5-alpha-steroid 4-dehydrogenase

Sequence
4810 bases(100 bases per row)
TATCAGGTGCTGGGCGTCGACCCGTCCTGCGGCAGCGAGGAGCTGCGCCGCGCCTACCACCGTGCCGCGCGGCAGTCCCACCCGGACAAGAGCGGTGCCG
ATGCTTCTTCAGCGCTCGCTGCCGGCGCGGCTGATCCGAACGCTCAGCACCAGCGCTTCCTGATGGTGCAGGAGGCGTACGAGGCGCTGCGGGACGGCGA
GCGGCGAGCGCAGTACGACCAGCTGCTCGCGCGGGACACGCTGCAGGCTGCGCGCAAGACCGATGCAGTCGTCGTGTCGGACGAGGTCGCGGTGGACGAG
ATGCAGCGCGAGGAGCTGGACGACGGCGAGGGCGGGGTCGAGGTGGTGCTGTCGTACGCGTGCCGCTGTGGCGACGTGTTCGAGGTGACCGAGGACGAGC
TGCGCGACGGCGTGGACGTGGTGCCCTGCACTGGGTGCTCGCAGCACATTCGAGTTATCTCCGTCCCGAGCTGATCTGCTCGGCTGCAAACAACACGAGA
TAGAGTTGCATGGTTGGATTTTGGTAATGAAAAGCACGAGCATTTCAGCGTTTAGAACCTTCAGCCTCTTTCACACTCGGAGGGTACACCAGCCTAGAAC
TCCTTCCCGCGCGGCGGGCCGTGCAGCGGGTACTTGGTCGGGGTCTGGATGCCGTGGAGCACGGTCAGCCCAATGTACGCCAGGAACACGAACAGCGCGC
CAAAGATCAGGCCAGTGAGCAGCTCCGGCGTCATGTGCACGTAATGCGAAAAGCAGAACGCCTTGCCCGCCTGCGTGTAGCCCACGATGTAGCCCACGTC
GCACGTGATTGTTGCCGTGGCGCTGGATTCCTGGGCCGCAAGACGGCGGGTGTACGAGTTGATTGCCTCGACCGGGACAGCGTCGTCGGCGGTCAGCGCG
AAGTCCGTCAAGCCGCCAGTCGCTTGGGACAGAGACTGCGCGGCCGACTTGATAATCGCGTCCGCCTCCGGGAGAGTCTTGGTGTCGAAGATCTCCACGA
CGACGACATTAGTCTTGCCATCGGAGAGCAGGGAATGCCAGCTGCCGCCGCTTGCAATCGCATCCTGCGAGTTTTAGTGTCATGTCAACAGGTTTGCACT
GGAGATACATCACTCGGGACAGCAGCCTGCGTACCTTGAGATCGCTGTGCGAGACCACAGGCGCAATCGGCGACAGAGCATGGCTCAATGACGACGTGCG
CGTCGTGTGGGTGACCACGACCGAGGACGCAGCGCCTTGTACCGCGGTCTGCACGAACGAGCGTTCGCCGGCGACCGCAAAACTGGACACTTCATCCGCG
CTGAGCGACGGCAGCAGGAACACGCAGAGCAGCTCTGCCTGGCGCGAATTGTCCTGCTGATTGTTTAGCAGTCCCTGGGCGAGAGTAGCACAGTAAGCTC
CCGACCGATGTTTGCAATATTTGCGACTCAAGAACCACATACCCAGTTGCTCTTGCCCTGCGCCGCCTCCTTCAGCGCGAACGCCACGTCCTGTTCGTTC
ATGGTCGCGCTCGAGTAGGCGTTCTTGCCGCTGAACACGCTGCGGTGGCAAAATCCTTTCGTGAAAAGACAGCGAGAAGATCCACGACAACTCGAGTCCC
ACTTACGAGCGCTCCGACCACAGCAGCAGCGGAGAGTTCGGGTACAGCACGCTCGTCGACGCAACCGCAGTCGACACCGCGCTCATTGCGCTCCAGAGGA
GTCCCGCGACGACCGACGCCTTCATATTCGCTCAGTTTCCTGGGCGACTTCTCCCTCCGTCTCCGTTTCTGGTTGCCGTTTCCAAGATTGGGGCGGCACA
AAAGCAGGGGCGATGTTAATTAACGTGATGTGATATATCGGTTAAAATGCATATCAATTGCACCGCGATTCAAATTCGAATCGGCTTCCTTGCTTTTTCC
ACCCCCTCGACTCGAGCAAAACCAACAGCGACCGACCACTTCAGTAAGCGGTCTGCTCTGTGCGCTGCCTCTGTGTGCCGGCTCCATCGCGGCCCCCCTC
CCCCTCAGAGCGACCTCGCGCGTGTAGCTGGTTGCTGTCCCCCACCTCCGACCGCAGGCCTCCGCTATCGCTGCTCCTCTGTAATCCCACCAGCCCAACA
TGTCGTCGATTCTCGCCTCGCTCGACATGAGTCTGGACGACCTGATCGCGCAAAAGAAGACGCGCAACAGCACCGCGGACGCGCGGCCGGCCAAGAAGGG
CGGAAAGAACGATGCCGGCGGCGCGGGCCCCGTGCGGGGCCGCCAGCGCAACACGAACCGCCGCCGCAACCAGCCGTACTCGCGACCTGTAAGTTGCCGC
TGCTGCTCTTGATTCTCCCCCGGCCGGCGGGCTGTGGCGCGACCCCAGCGCATCGGGAAACGAGCGAAGGACGGCGAGCTGCCATCCGGCAGCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACGCGCTCCTCGCACCGTGCCGGCGAATCTCCAACCCCCCGCGTCGCTCGATGGTAACCTT
TTCTCGCTCTCTTCTGCAAGAACAACGACAACGACGACGGCATGGACGTTGACGACGATGACGACGCGCCGCCGCCGAAGCGGGACGCGGGCAAGAAGCG
CTCGGTCGTGGTGAAGACCCAAGGGAAGGGGAAGGGCGGCAAGAAAGGTACCGATTTTTCAACCCAGCTCGTCCGCGCTGTGCGGGTCAAGACAGACCCT
GACCGCCATGGTCGCTATTCTCTGCTGTGCGAGCAGGCTCGTCCATCCTGGAGCGCCTCGGGTCGAACGACAAGAGCAGCAACGCGAGCTCTGGCGTCAA
GGTTCTGGTGAAGAACCTGAAGTATGATATCTTGGAGGACGACGTCCGGGAGCTCTTCGGCACGGTCGGCAAGGTGTCGCAGGCCGAGATTGTGTACGAC
CGCTCTGGCCGCTCGAAGGGCATTGCGCGCGTGTGGTTCGAGCGCCGCGCGGACGCGGAGAAGGCGATCAAGCAGTACGATGGTGAGTTGCAGGGCTTTT
GTACGACAGTGTGATGGAGGCTGTTGTTTTCTCACGCTTGGTTTTGTTGTTGTTCAGGCCGCACGCTGGACGGCAAGCCCATGCAGATCAGTCTGGACCA
GGACTCGAACGTTCGTCAGGGTCTCTTTGGGACGGCTCTGCGCGACGACAGCAATGTCAAGTTCAAGGTGTCGTTCGGGTACGAATCTGTGTGCTCTCTG
ACTTGAGGCGCACAGACCATTAATTGCTTTGTTTTGTGGTGGTTGCAGCGACAATGGCGACGAACAGAAGGGCCGCGGCGGCGGTGCAGGCAACGCCGGC
CGTCGTCGTCGTGGCGGTCGTGGCGGGTATGTCTGTGTGTTGGCTTGAGGGGCATAGGTGACCAGCGTTCTGACTCGGTTGATCGTGGTGTGTTGAACAG
CAACCCGCGCGGGAACAACGCTCCGGCCAAGACGACCGAAGATCTCGACAACGAGATGGATACGTACATGAAGGATGCGTAAGTCGAGGTCTGCTGGACG
GTTGCAACATTACAACCGGGAGCGAAGCGCGCGTTGAAGGACATTCGATGTGCTCGCTCGCGACCCGGCTCGTTTTGCATAGGATTTTGGTAATTCGCTA
GGTTTTTAATGGACTTGCAGCCGCTGCGGACTTCACGTGCCTGTGCTCTATGGAGCGAGTTCACGCTCTCCATTCGAACGATGGTGGGCACGCAAGGATC
CTTGAACCGAAGAGAGCTGAGGTTCACGTGTCAGGTCGCCCCGCTTGACTGTAAACAAGGACAGTCGAAGTGCGGATGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTTGGCTCACGCGCCAATCCCCAACTGCGTCAGCAAGTTCGAATCAGGCCGCGTCCTGTCCTTGTCTGCCGCGTGAAGAGAGTGAATCCAAGCGG
GAGATGCCCGTGGGACGCAGGTAGGCGGCTGGTCAGCGTCTGCTCGGCGTCTGCTCACATTGTTCGATCAGTCTCAAGACCCAAGGAGCCGCAGACACGA
TGGAGAACACCGGCAGCGTTAGCGCGCCGATCTGGCTCGGTCTGTCCGAGCAGGAGCTGCACGGCTGGCTCGTCGTGGGCGTGTTCGCGCTCGGCGCCAT
CACGTGGGTGGCGACGAGCCTCGTCACGGCCCCGTACGGCCGCCACAACCGCCCTGGATGGGGTCCAAGTATCGACACCCGCCTCGGGTGGGTGCTGATG
GAGTGCCCCTCCGCTTTGTGGTTCACGCTGGTGTTCTCGTGGGGCGACCATCGCTGGCAGACGACGCCGGTGCTCGGCGCCGCGCTGTGGCTGTGCCACT
ACGTGTACCGCGCGGGCATCTACCCGTTCCTGATCCGCTCGAGCCCCAGCAAGCGCATGCCGCTGACCGTCGTGCTCTGTGGGGACGCCTACAACATGGT
GAACGCCTACGTGAACGCGCGCTACCTGAGCCAGTTCGGCGACTACAGCGCGGACGATCCGTTCGCGCGGCCGTCGTTCTACGCTGGCGCGGCGCTGTTC
GTGTTCGGGCTGGCGGTCAACATCCAGTCTGACCAGATCCTCATCCACCTGCGCAAGCCGAGCGAGACGGGCTACAAGATCCCGCGCGGCGGCATGTTCG
AGCTCGTGACGGCGCCGAACTACCTGGGCGAGATCATTGAGTGGGCGGGCTGGAGCCTGCTGACGCAGTCGCCCGCCGGCTGGTCCTTCGCGGTGTACAC
GGCGACCAACCTCGTCCCGCGCGCGATCAGCAACCACGGCTGGTACCTCGACAAGTTCAAGGAGACGTACCCGAGGAACCGCCGCGCCATCCTGCCGTGG
ATCTGGTGAG