Description :
From Genome Similarity Track
Location :
Scaffold_347:227623- 228684
Transcript NameFunction/comments
Aphin_H310_11679HECT E3 ubiquitin ligase, putative

Sequence
1061 bases(100 bases per row)
TACACCATCGTGAACGCCATGCTCTGGATGTTGACAAGGGCACACAGGCCCTCGGCCAGCAGCGCCCTCGTGGGGTAGATCGGGAGGTCGATGCGGTTAA
AGCACGAGTGCACCTTGGGGAAAACGCCGCGCTCGTACGGCACGCCGTGCAGCGAAAACGGGCATAGCTGGCTCGTCAACGCACGAAAGCCCTGCAACGG
CACGCGAGACGATCCGGTCGTGAACTGGAGCAGCTTGGCCCGCTCCGACGCCGTCATGTCAAACTCGATGACGTCCCAGAACCAACCGACCACGTCCTCC
AACGACTTGGACACGATCGTCGACCGCTTCCAGTCGGCCACGTCGATCTCGGAAAACCCACACAGGATCAACTCGAGCTCCTTGTAATCGAACGGCATCA
ACAGCTCCTGCGGCAGCACGTCGTACAGGCCCTGGACCAAATGCTGTAGCTGCGGCGCGACCCGGTCAAACAGCAAGTACTGCACCATCCTGTCCACGTA
CTCGGCCTTGTTGGCGTTCGTGACGGCGATATCTCGTCCGCCAACCACAAGCTCGACCTCCGACCCGGCTTCGTCCACCGTCACACTGAACGTGAGCGCG
AGATCGTCGACGTCGTCGCAGTCTCGGACGTACACGAGGCTCGAGTACACAGTCGGGTCGAGATACCGAATGTCGTCCATGGAGACAGGATACCCCAGGA
GCATCTTGAAGAGGGGGACGCAAAAGTGGAATGGCAGGACTTGCTCGTCAATGATAGCTCGGCCCAGCAACCGGCCGATGGCCAAGTATCGATCCAAGTG
GTTCGCGCCATGGACGTTTTCCGAGTTGGGGTTGATGTAGTAGGACTGGTCGGCGTTGTTGGTTACTGTAAAGAGCCCTCTCCGTTCATCCATGATGGCC
ATCGTGAGCAGCGTGTACCATTCCCGTGTGACTCCGCCGGCGTCGACTGCGCTCTCTCCAACCAGCGAGATGATGGTCAAGAAGCAGAGCTGGTCTGTAG
GAGCCTTGGTCAAGGCATACATGGACTGGTCGAAGATGGATTCGCGACGTAGCGTTAGCTT