Description :
From Genome Similarity Track
Location :
Scaffold_336:22762- 25588
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_336-snap-gene-0.14Gallus gallus similar to synaptotagmin VIId (LOC426016), mRNA.

Sequence
2826 bases(100 bases per row)
AACTTTCCCCTTTACGTCAAGGGAGAACACATCCCGTAGATCATCAATGGTTTCGATGGCGTCTTCAAAAATCACCTCATATGCTTCATCTGGGAAAGGG
TGATACTGGTGCACCCTGGCGGGGAAGAAACGGCCTCCATTTACACATTTACGATATGCCATCACGCGCTGATCATACGCCAGAATTTCGCGACCATCGT
CTTCGACAATTCCCTTTGATTCAAGCTTGCATATCTCATAACGTTTCAACCAAGCAGTTTGCTTTTGTCCATCTTCTGAAAGTAGCTCACGAACTGGTCG
AGTTGATTGCGTGGCAAGATCTCTAGAGTAGACGTGAAGCGATAAGTAAGAGAGGTGTTGCAACTCTTTCACGTTTCCAAAaGTAAATTCTTGTTCTGGC
CACTTCGGGTTTCTTGAGCCGTAAACAGTCAAACTCTGTTGTTTTTCCTGGTGGAGAAGTTGGCCATTTGCAAGAACAGGTATGACTGTAAAGTAGGCGT
TAGTAGCTGCACGTTGGCCTAATACACACCCACGATAaCTtGTTTCACGTGTtCCTTGACCGGCACAGTGACTAATATCGaGTAAATTGCGCGCGCCATG
CACCCGTAAGTGAAGCATATACTTCTCTGCTTGGATACTTTTGCTCTCGCTGAACATCCCAGGgTATGACAaCGAAAGCGTGAAACGTTCCTTACGCCAC
TTCGCCGACGTTCCACTCGCTGCCACAGTTCTGAGCTGTTTCCCCTTTTCAATGATTTCGGTAACCTCTTCATCTTCTGGATAATTTCCGACCAGTGACA
TTGATGACAACCCAGaCTGACCATCGAGGTCAGAGGAGAAGGACTGCATCGAAGTCGCGAAAGTCAGCATCTTTCCCGGGGCATCCTCTGTAGCGGATCG
TTGAAGCATCTCAGCGAGCACCGTCGCGTCACCGATAACCTCGGTCTTTATGCACAACTCGCCCAAACTTTGGCTGTGCTTCTTCATCGACGGTTCAGGA
ATTAGCGAGTATCTCTTCTCCTTTTCTGTTGACGTGATCGAAGTCGAAGTCGCCGATGCATGGCAAAGATCGGAAACAGGTATCTGCACCCGGCCCAGCG
GTGCGCTCCGACCAAAATTGTGATCCTTGATATGAATTATTAACGAACCAGCGTTCTGGAGTGGAAAGTTCTGACAGACATTTTAACGTATTTGGTGAGT
GAGGGCATCTTACGCACACCTATTGTTTACTTACACTGCCGAGATAGAAGACTTCATTCTCCCACACTGGGTTGAGAGTCTTCGAGATGACTGCTGTTCG
CTTTTTTTCCACATCCACAGGCTTACCCGTCGTTCTATCTGTGACAGTGAGGGTACAATATGGGTCGCTGTACCCACTGTAGTCAACTCCGAGAAAACCA
TGGCCACTCTTGATTTCGACCTTAAGCATGGGTTGATCTGGGGAGAGGTCTAGCTGCCGTTCAGATCGTACTTCATTCTTCGCCAACTTGGCTCGATGTG
CAGACACCTCGGCTTGCGCGCGCTTAGCAAATaTACCCGCTCGCGCTTGACCACCAGGTGTGTTAGAGTCAACACGACGCGTCCGTTTAGGAGATTGCGG
CAACGTCGTGTGCTTGCATTCCTCGATGCAGACTGAAGGGTCAAGTTCGATTACAGCATACGGGTTTGTCGCTGTGATTAAAGTCCCATCTTTCTTAAGT
TCAGCCGTACCCAGCACGTCAACTTCGAGCACTGCTTGACCTTCGATCCCAGCTCGCGCTTGAAAATTTTCATCTGTCGAGGTCTTTTCTCGGTGAACAC
GTGGCAGCTGAGAGTTGAGATAATGGATGCACCCGTTGATCCCATAGAATTGAGGGTTTCTGTTCTGGTAATTCTCAACAGTACAGGAGATACGAGCACC
ATCCAAACTGCAAGCAGCTTCATGCAGCTGGTGTTGAGCGTTCTCTAGTTCAAGCTGCTCCACGGATAATTCATGGGTTTTTGAGGCTACTTCCTTGTCG
ATTTCTCGTCTCCGATGCCGTTCGCCACGAGTCTCACCGATAAGTGAGATCTGCAATTGGACAGCACCGAGATCCTGGCGGATCGCCATACCTGGCTCGG
GCTGTAGGTCGTACCACTTCTTCAAGTTATTGGCAGATAGGTCATCCAGTTCGATCACTACGCAACCCAGTGGATCGTTCCTGCTGTGTGCATCCGAATG
AAGAACACGGACACGGAGTTGGGACGCTTCGTCAATTCGGCATATCCAACCGAAAACATAATGTTCGTCTGCCCATTGCGGGTTTCTTGTCGTTTTCTTG
ACTTCTGTCCGGAATGACTCTCCTCTGATTTCCTTGCCCTTCTCGTCAAGGAGCGAGAGCTCAACGTACGGATCACTTGACTTGTTAAAGTCAGCAGCAA
TCAGCTGCCGAGCTGCCAACACGGTAACCTCTAGTCGATTGTCGGTATGCTCAAATCCGTCTGTGACGATACGGCTTTGTGGTGAAaCCGTCAAATGCAT
ACTCTGGAAGAAGTTGACCAGGTTTGGACCAGCAATACTCATCACCACCcGgAGCTCTCCATGATTCTTGATCATCGCTTGTTTTTCCACTGACTCTTTC
CTAGGAGATGATCCGCCAGTAGCGTACGCGACGGCGCTGTtCATAGCAGACACGATCCCTCCAGTTGGATTGGGTGgCTcGACaCGAAaCCaCcGATCGA
CTAACTCGGACTGTCcGGTGCTTGCCGGCGACATCTGAAAAaTGgACAGCGgCAcTTGAaCAAaGCCAAGCGATGaGTTTTCATCACGTGGTCATGGTCC
CAGagCTCGAAaTGAATGGCgTCcAC