Description :
From Genome Similarity Track
Location :
Scaffold_200:22760- 28056
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_200-snap-gene-0.21Poly [ADP-ribose] polymerase 2
Pytir_DAOMBR486maker-pir_contig_200-fgenesh-gene-0.12CAAX prenyl protease 1

Sequence
5296 bases(100 bases per row)
GTGGCCCACGCTACTTTAGTGGATCTTGAGAAGCTGTGTGCCCTTTTTCCTTCTTTTGTTCTCCAGGCATTGACGAGACGGACAGACAGAAACGCGAGCG
ACGGACGACTCCAACGTGATGATGGTCATCACCAGCCTCGCCACAGAGAGGAAGAGAAAGAGAGAAGGCACGAGGCGTGTGCGAGTGTATATGTGGATAA
GTGAGTACCGCTCATTTGTGTGTGGTCACAGTGAGCGCCTGGTGCGTCTTCCCGTGACGGACTGGCTCATTTAATTGCTCGGCGCTTGTTGAAGGCGGGC
GGCGGATGACGTCAGAAGAGCAAGCGGCGGCGGGTTAGAGAAAGAAGAGCGGCGCGCCACGTGCGGCAGGGTGAAGACAAGGAACCAAGCGGCGCGCTCA
CAGCAAGATCTCCTCGTGAGTGCGCTACGCTACTGTAGCAGTGCATGCGGACGAGTGGCTCTTTGCGTGTGTATTGCTCGCTGTACTAAACCGTCGTGAC
GTGATGTGTGCATTTCGATTTCTTGGTATCACGACACGTGCAAAGTAATCGTCATACTCATGACCATTTCATTACCGACCACAGGCGCTGCCATCATAGC
CCATACATAACGCCGCTTAGCCTACCACCAGGTAGGCATGCGTGCGTGCGCATGTACGGAAGAATCTCGCCCACCTCCTTCCTACTTCCTTCACGTACAC
ACATTTCGCTGCCGCCATCGGCCAAACAATCGGTATCGCTACCGGTTTTACTCCAAAGGGAAGCGGGCTTGCAGGCTCCAAAATGGGTTTGGCCGCTGGG
CATCTTTCTCCGGGTTTGAGCGAATGAGTGTGCGAACACATCCCTCTCACATTCTTCTTCTTCTTCTTCGCCACTTGCTCCCCGACCCCACCTGGTCGCA
GACGAGCTCCCTTCCCCTCCCCTCTCTTCCTTCCACGCTCACTCGTCAACGGCCGCTTCACACACAGCTTCACGCGACGGCAACGCGGACAGACAGACGG
ACAGAGCTCTTCATTACAACACACACACACGCACGCATATCCATACGCGCTAGCGTTTCGTCATATCACTATGACCCGGAAGCGCCGCATGACCAAGCCT
GCACCTGCGCCAGTGGCCACTTCAGCGTTGGGGCCGCCTACGCACTCGCCCGCGCGCAGCACGCGCAGCGCGGCGTCGTCCGTGCTGTCGCTGTTGACGC
CGCCGACGAGAGCCAAGTCTTCTTCATCATCGTCGTCATCGGCATTCGCCGACCTGCCCGTGTTGTCGCCGCCGCTTAAGAAGCGCGTGCACACGCGCAG
CGACGCGCGCGCGGTCAAGGTCCAGAGCCTCGAGGAAGCACTGGACGAGCAGGACGAGTACGACGACCAGCAGCGCTTTGTGGATGGCGACGGGTATGGC
GACAGTCAGAGTAATACCAGCAACAGTAACACACAGCGCCACAACATCAAGCCTGACCCGCATCTCCCGGATCCGTACAAGCGCGCTGCTAAGGTGCTCC
ACTACAAAGGCTCGGTCTACGACGCCATGCTCACGCGGGTAAGATGCGAGAACACACACAATGTTGCCCATGTATCTATTGCTAATGTTTGGCTAACATC
TATGTCACGTGTAATTTGCAATAGGCGCGCGTGCACCAGAACCAGTGCGAGTTCATTGCGCTGCAGGCGCTCGAGTACGAGAACCAATTTTACCTGTGGA
CGCGCTCGGGCAGCATTGGATACACGGGGAAAACGCTGCTCATGGGGCCGTACGAGTGCGAGGAGCGCATCATTGTGGAGTTTTGCATGGTCTTCTCGTC
CAAGACCAGCTGCACGTGGGAAGAGCGCCACTCGCTGCAATACCAGGAAGGAAGGTGTGTGTTGTATGCAGCGTCTTTGACTAATGTACTAACCCATAGG
CGGTGTGGAAGGTGGAAGCTCAAGAAGCGCAAGTCTTTGCTGAGCTCCTCTCTCATGCGCGCTGTATGTGCTTGTTTATCTATCTGCCTGCTATTTGATG
TAGCTTTACGTGGATTGAGCTCGACTATTCCATGGGCACGCCATATGCTGACCTCTCGAGTTCGCTGCTCGATAGCGGAGATGACTATGAAGACCCAGGC
AGTAGCTCGCGCACAGGTCAGAAGCGACGAAGAACCTCCAGATCGTCTTCAACTTCGTCATCATCATCGTCTAGCCGTCAGTACAATTTCGTACAGGACT
GGAATAGTTCGTCTTCTGGCAATGCGGCAGCACTGTCAGCGAGCAAGCGAACAGCTACAGCAGCTGCGTTGTGCCCGCCCGCGTCACGACTGCATGCAGA
AGTGCAGTCGTTTCTAAATTTGATTGCAGATCCACACGAATACCACTCGTACAACTACTCGGAGACGGAAGAAGTGATGGAGGAAGCCCAGAAAATGCCG
CTCGGACGGCTTTCCAAGACGACCATCAAGCGGGTATGATACTATTTATTCTATTTGGCTATGGTTATCCCAAGGGCTATTTTTTCTAATCAGCAGGCTT
TTTTGCAGGGCTACGAGACGTTGCAGCAGATTTATGAAGCACTGCGTACGCGCACGGCGTGCCGAACGCGGATTTTGAACCTGAGCTCACACTTTTACTC
GATTATCCCGCACCACTCGCGATTGGACGTGATTGATACGATGGTGAAGCTTGGCAAGAAGGTGGCGATGATGGAGAGCGTGTGCGAGAACGTGCGCGGC
ATGAGCGCCATGGAGGTCGTGAACGCGTGCAAGCAGCGCAACTACCTGAACGAGTGCTACGCGCTGCTGGGCTGCGACATGCTGCCAGTCTCGGAGAACT
CGGATGAGTTCGCATTCGTGAAGGCGTATCTGAAGAACTCGAGCTGCTGCGGCTGGAAAGATGGCACGCTGCAGCTTTTGAATGTCTTCCGCGTCTACAA
GCCCGACGAGGACGACCGCTTCGAGCCCTACCGAGATTTCCCCAACCGACGAGTGAGTGAATGCGCGAAATCGGTTTTGTGCTTGGTCGGCAATGCTGAC
AATGCTGACAGTTTCTAACCTAATCTTGGTATTCGCATGTATCTTTCATGTTTCTGGCAGATTTTGTGGCACGGTAGTCGCATGAGCAACTGGCTAGGCA
TCCTCACGGACGGCCTCCGCATCGCGCCGCCCGAGGTCGCGTCCAACGGCCGCATCTTCGGCAAAGGTATTTATTTCACAGACAAGGCGTCCAAGGCGCA
GGCGTACTGCCATGCGAGCGCGCGCCACGGGGGCTCGCAGAACAAGTGCGTGTTCGTGCTGAGCGAGGTGGCGCTGGGCGACGTGAAGGAGATGGTGTCG
TCGGACGAGAACGCCAAGCGCTGGGTGCACGTGAGCTGCGGTGGCCACACGAAGGCCTCAGCTTTCAACAGCTGCAAGGGCGTAGGCACGTGCCGCCCCG
ATGCGAGCGGCGACGTGGTGGACAAGGACGGCGCAGTGTGGCCGCTCGGCAAGCCCGTGCAGACGGCCGAGGCCACGGGGCTGAGCCACTCGGAGTACAT
CATTTACAACCCCGCCCAGGCACGCATGCGCTACGTCGTCGTGGCGAAGAGCGCCTACTAGGAAGTTTGCTTTAGACCCTTGTTCGTTGCTCGTGTGTTG
TTGATATTGGTGGTAGGTAGGTAGTGTTGTATTTGTTTGGTTGGGACTCGGATTTTTTGTGTATTTTGTATGGCATAATGCTCTCTTTCTCACTTTTCAT
CTTGGCTTTCTTGTGGGTCTGTCTGTATGAATGAATGCGTGAATATGGATGGCGACGAGCTCCGCCCAAAGCGAAGAGCTCATTCAAGTTTAAACTTACT
TGAGCTTCTTGGCGCGATCCGTGATCGCGTTGAGCCGCTCGACGAGGGGCGGGTGGCTGTAGTGGTAGGCGCTGTAGAGTGCGTCTGGGTTCATGTTGGA
GAGGTTCTCGATCGCGAGTTTCGTGAGCCCCGAACGCAGCCCCTCCTCGTGGCCCAGGTCCACGGCAAACGCATCGGCCTGGAACTCGTTCTTGCGCGTG
TTGAGCGTGATTAGGAACGACAGTACATGCTCCACGGGTGCCCACACCGTCTGCGAGAACAACAGGAAGCCGATGATCACGGGCTTGGAGTCGTTCGAAA
AGCCAAAGCTCGCAAACAACTCTGCGTCGTTCATGCAGAGCCCAAACACGTAAAAGCACGCGAACGTGTACACCTGCTGGATCGCAAAGCCCTGCGCCGT
GTGCCAGAGCTTCCAGTGACCGAGCTCGTGGCCGAGGATCGCAATGATCTCATCGTGCGTGGCCTGCTCCAGCAGCGTGTCGAAGAGCACGATGCGCTTG
CTCTTGAAGAAGCCGAAGAAGTACGCGTTGCTGTGGCTCGAGCGCTTGGAGCCGTCGCACACAAAGAGCTTCGCGAGTGGGAACGCGAGACTGGACGCCA
GCGCCTCAATGCGCGTACGTAGCTCGCCCTCGTCCAGCGGCGTGAACTTGTTGAACAGCGGCATGATCAGCACCGGGTAGAGCGTCAGCATCACCAACGA
GAACGCGAATAGGAACGCCCACACGTACAGGTAGAAGTACGCGCCGCCCCAGCGAATCACAAATATCAACCCCGCGGTCACAGGATACCCAATGACCATG
AACAGCAGAAAGCCCTTGATCTTGTCCATGAAGAAGAGCCCCAGCGTCTGCTTGTTGAAGCCGTGACGCGCCTCGACCACAAACGTCGAGTATAGTGAGA
ACGGGAGCCCCACGAGCGTGTCGCGGATCGACGTGAGCGTCAGCAGCATGATCGCGAGGTAGATCTCATTCGTCTCGTCCACGCCAATCGCCGCAAGCAC
GCGGCCGCTGAGTGTCCACATGAACGGCAAGTAGCCGAGAAAGAGCAGCGTGGTCGCCTCCACCTGCGAGTACGCGCCAGAGATGAAGCCGAACGTGCTC
TTGTCGAGTCCGTACGCGCGGCTCTTGTCAAACTTCTCAAGTGTCGCGTCCAGCAGCGAGATCTGCTCACTGTCTTCCTGCTTCTTGTCGTCACCGTCAT
CGCTATTAGTCTCTTCTTCTTCGGTTTTGGTCTTCTCCTTCTTCTTCTTGGTCGTGAATGTGCCCAGCGAGCCGATCGCGTCTCTCAGCGGCTCGGGGAA
CTTCTTCTCCTTGAGCTTCTGGTGCTGGCGGAAGTCCAGATACGTCTCGAAAATGTACACGAGCGTGATGAAGACAACCGCGGCCTGGAAGTACGGCACG
GAGCCTGGCCGCCAGCCCTCCTGTGTGAAGTACGGCGCGCTCCACCACGCGTGCGGAGGTGGCGGGAGCTCTTGGATCGTCTCGTTCATGGTGATG