Description :
From Genome Similarity Track
Location :
Scaffold_221:22760- 24383
Transcript NameFunction/comments
Physo_144636putative gag-pol polyprotein

Sequence
1623 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAAGAAAGAGCTTGTTCGCCAGGCTCTTCTTCTCGAAGTGTCCCTCGAGTCTTGACCATGCATCATGCGCATCCTT
CGCCGACCGCACCAGCGGCAGCTGCGAGTCCTCCAACGCGAGACAGACGATCGCCAGCGCCTTGCGCGACTTCTTGCGAAACGTCGCTTGGTCCGCCGCG
GTCGTGCACTGCTCGAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCCAGCACCATCTGCATCTTGAACTTCCATGTGTGGAAGTTGG
TTCCGTCGAACTTGTTGATGCGGGCGGTCGCGGTCGGGGCGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTCAGGGAAGACGGGGCTTGGGCTCAT
AACCAAAAGGAAGAACACTTGAGCAGTAGTTGGCAAAATGCAAAGTGATTCGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTACT
GGATACCTCTTACTGGATACACCCTACTGGATTCTCTACTGGATACACAGTTACCTTATCCAATCAGAGAACGCCACGTCGATGCCCATCTTGTACCCAC
AATCTTGGCGTAATCACCGTGAC