Description :
From Genome Similarity Track
Location :
Scaffold_1635:2276- 6260
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1635-snap-gene-0.6Serine protease family S28
Pytar_ATCC12531maker-par_contig_1635-fgenesh-gene-0.1Appr-1-p processing enzyme domain protein

Sequence
3984 bases(100 bases per row)
TGAATCCATCCTACAACTACTACGCCATCATCATATCTATGGGCACTTAATATCAAAGTCATTTTCTCCTCCACCTCTTGCTTTCTCATACAGTGAGTCC
AAACGCCAACCACTGAGGAGCTGTGCCTTCAGCAGCAGAACTGAATATGAAACTAGTCCGCTTCAAGACGAACGTAGCCGGCACGGCGAGCCCTCGGTCG
GTCACGCACGAGGTCCGACTTGATCACAGCGAACAGCACGAGCAATGCCAACAGCACAGGCACCAACACGAGCGGCGACGAGCGGTCCACCGCCTGCACT
TCCTTCTTCTGCTCGCCAGAAACGATCATGTCCTGAATTGCAGCGTCGGTCGTGAAAACCTGGACGGCCGCGTCGGCACGAGCGTTGTCCCCATTGAGCC
ACTTGGTGAGGTACTTGATGATCTCTTGCTGCTGCTGCTTAAGCGGCGCAGGTGCGTTGGGCCTGGGCGCAGACAGATCACCGCAGTGGCCGCAGAGATC
GCACTTTGCGAGGAAGGCGACCTCGTCGTCCGAGAGCGTCTCGAGCACGGACGCACGCTGCCACGGGTCGTCCCCGCCGTTGGCGAAAAAGATGTTGTGG
GCCTTTGGCGACGCGCCACCGTAGAGCTGGATAATCTCCTCAACGCCCTTGGCAGGGTTCACCACGTCGCCAAAAACTGCACGGCACTGCTGGAGGTGGT
ACTCGAGATTCACGATTGACGCGCGAAGGCTTCCGGTCGCTGGCGCCGTCTGAAAGTACGCGAGCTGCGAACACTTTTGCCAGCGCCACGACCGCACGTC
GGCCCAACGCGACTTGTCGTGGGCCAGACACGTCGTGTCGTAGAAGCACCCACTGCCAAAGGCGTCGCCGTACATGTCGATCGTAAACTTTGCAAATGCC
TCGGGCAGAGGGAGCTTCTGGTCGACAGCGTCCGTCATAGCCTTGCACACGACGTCCTTGTGGCCGTACTGCACGGCCATGGCTGCGGCGTCGGCAAGCA
TGTAGAAAAAGTCGGCGTCCGCCAACGCCTGTGCGCCCAGCAGACTCTTGACGCGCGTGGCGTTGCCGCGCTGGATCTCATCTTCAAAGGCGCGGGTCGT
TTGCCGCAAGGCGTCAGCACATTTCGGCCCCGCCGACTCCGCGACCTGTTCGTCAAACCCGTGGAACTCGTAGATGGGCAAGACGACCCCGGAGGACGAC
AGCGCAGCGACGGTCGTGTTGGGGTAGGCCACACGGAACCACGCAGACAGCGCGCCAGGGTACGAGCCGCCGATCGCGACCCATTTCGGCGGCGCCGTCC
TACCGCCGAGGAGAAGCAGGTTGTGCAGCTCGTACTGCTCCTTGAAGTACTTGAGGTCGGCGAGCGCCTGCTGCACTGTGAGGTACTTGTAGTTTTCCGT
CGAGAGGTCGTTGTTGGGGATGCTCTTGCCGTAAAAGCGGTGCTCAAGCGCAAGCACCTTGGCGCCCCAGCGCTGCGCGAGCGTGTCGATGAAGCCGCCG
GTGGGCGGCCGGTCTAGTGCGCCCTCACCGCCGATCGAGAGGATCACGGGCCCGTCTGGACTCTTCCAATGGGTGTTGACCTCGTAGAATCGCTGCTGGA
AGGTCGACGTGTCGCTCTCGGAGAAGTGGTCCACGCGCTGCTTGAACCAGAGCTCCGGCGACGACGCCGAAAAGAGCCCCTGGGTCTCGGCCTGGATCAT
GGCCCACAGGCGGCCGTTGCGCGCGTGAGAGGGCAGCGTCGACGCACGCACATCAGCAGTGGGTCCCGTGGCATAGAGAGCGAGTAGAAAGACCGCAGTG
CGGCGCAGGAACGACGCCATCGCGACGAGGCAGGCGGCGATGGCGGACGAAGATCGATGCGGAGTTGACTGCGGATGTGAGATCTTCGACTTTGGAAGAA
AATTCTGGCATGATCGTATTGGCTAATAATGTAGTGCATTTTAGCCAACCAAGTACCGCGTATCCAGGTCGAAGTTGAGGTGTCTGCGACGTGTGTGGCC
AGACTTCTTGGCGGCTCGTCCCAGATTGTTCTCTCTCTCCGGCAGGCTCTCCGGCATTGCGTTGTTCGACGGTTGGCACTCCCGGCATGGCCCGCCAACG
GAAGCGTTCCCGAGACACCACTGACGACGCGCCGCGGCGAGTCACTCGCTCGCAAACCCACCGAGACAAAACCGAAGTCGGGTCCTCGGCCATGGCGACC
ACCGCACCGTTACCACGATCAGCCCACCGATTTGTGGAGACACTCGTCGCCCACGGAGAGCTCTTTTCGGACCGCCTGCTGCGTTTCTTGCCCACAGACG
ACTTGGTGAACCTTTGCGACGCGCTCGACGGCACAGGCGTTGGGAGGCGACTACTCACCAACGCTGCGCTGTGGAAGTATGTGACGGTACGCGATGGGCT
TGACGGTGCAACTACGATCACACCGACGGTGGCGTGCCGCTCGGGAGGACCAGAACTCAACGAGTATTTGAGTCGCCGAAGCCAACTCGAGCAGTTCGAT
GCGAGTATCTTTGTGCTCGCCGGAGACTTAGGGACCATAACAGACGTGAATGGTCTGCGTGTGGACTGCTTGGCGTTTCCCACGTCTTCTTCGTTCCGCA
ATCCGGGCATCGGCGTTGCCGGCTGCGTGCACCGCCGTATCGGTGTGAACGTGGACCGCTATATCCCGACTGCGAGCGAACGCCCCGATATTCGTGAGGT
TCTCACGACACCGGGCGACGGTGATATCAAGTTGCTTGTCCACTGTGTTGGGCCATCTCGATTCGATCGCGATCGTCGAGTGCGACTCTACAACACGTAC
AGCAAGGCGTTACTTGCCATTGAGAGAGCCGCGAGTGTCAAGTGTGCGGCGTTTGCATCGATCTCGACCGGTACGCTCCAGTATCCCAAGCAAGAGGCTG
CCGAAGTCGCGATGGCAGCCGTTTGCGATGCATTCCGCACACGTCGTTTGCCTGCAGAGAAGCGCATCGCGTTCGTGTGTATCGAGAAGGACATGCTGAA
GGCGTTCGTGGCGGCGCATGCGACGGTTCGACGCTCGTTCTTCACGAGCGGCGCCGCCTTCCCAGCGACGATCCAGGAGATCCCAGCTCCATAAAAACAA
GCTTCCACAGGGGGCACTCCATGATGAGGGCTAGTTCCGTCTGAGTCGCGAGATTTGTGCAGAAGATTCGTGAGCAAGATCGTCTCGCGTATCGTCACAG
AGAGAATGTATTTTCACAGGCACATGGTGGTATAACTTCTTGGGTTATGGGATTGTGGCTGCCTGTGGTATCAAATCCAAGAGGCGAAGCCATTATTCCT
TTCGTTCACCCCCATTTCTATTCTGGTTGTCTGGATTGTGTTATTTTCTCCTCCATGAGAGATGCGTGCGCATCATAATTGCGTGGGCTTGTGGCCGTCG
AGAAGTGCGTTTTCTCCTCGATCCTCACAATGAAGGACCGCGTCGATCCAGCGGCTCCTGCGCCGTCACGACGACAGCATTCGATCGCGCTCGACAATGA
CTACCGCGACTCTGCGCGTGAGAAACTCTCTCTATCGCCTCTATCGCCCACTCTCTCCGAAGCCAGCAGTGCGTCGTCGTCGTCGCCCTTACCGAGCTCA
AGAAAGTATGCACGCAAAGAGAAGATCGGCCAAGGGTATGTCGTGGGTTGCACTTCTTACTTGTTTCCCTCTCTGTGATAATCGTCATCTTTATACAGCG
CCCAGGGATCTGTGTACCGCTGTGTCGAGGTCGCCACAGGGCGAGAGCTCGCGGTCAAGGTCATCATAACTCACGAGTTGTCGGCCGCCGAGATCGAGGC
GATCAAGCGCGAGGTCCGGACGATCAAGAAGCTCCAGCACGAAAACCTCGTTACGTATTACAAGGCGACCGAGAAAAAGGCCAAGCACCTCAGTATCTAT
ATGGAATACGTCGCTGGAGGGTCCCTGAGTGCCAGGCTTCGTCACGGTGGTGCGCTCCCGCTTGCGACCACGAGAAAGTACACA