Description :
From Genome Similarity Track
Location :
Scaffold_30:227583- 229206
Transcript NameFunction/comments
Phyra_78252ubiquitin family protein, putative
Phyra_78253pre-rRNA-processing protein TSR1

Sequence
1623 bases(100 bases per row)
GCAGCTCCAAACAATAGTATGGATCCTCAACTGCCTGCAGGTGCGCGCATCTCGATTCCGGGCATCGGTGGACTGCCTCTCATGTCTTCGGTAGTGTTCC
CATACTCTCTGGCAGCCGGCCTAGGCGGTAGCCATGCTACTACGACCTGGAACCTGGCGGATTTTGTAAGCCGGCTAACCAGTGAGCTGCCAATTTCCAC
TATCTACGGAGTCATGGCGGGTGATGCCACCCATCTACACCAGATCATGGCGCACATTGGCTTCGCTTTGTTCAGCGGCGTTGACGTTCCGCGGATATCA
AGACCGAACCTTCGTGCTTGGGCCCAAGACCTTGTAGACGAACTCCGCCGTTTGTTGCGCTCGAATGCGCTGCCTGCAGACGTGCTGGATCAAGTGAATG
GAGAGACTGAGCGACGCTCAGCGCTGGGGAACGAGCTTCTTCGTGTTATGGAGCCGTTTATCCCTGACCTCATCGACTACCTCGTCCGTGCCACGTCAGC
TAGTCGGGTCGCTGCATTTGGAACCAGCAGCTCAACATTTTTGCGTACAATGGTCCGGCAAGTTGTCCACCAACTCCGTTCCTACGCAAGAGACTCGACA
GAATCCGAAGACGAGAGCGACGAGCGATTGAAGCGTCTGCTGCGAGGACTACTAATCTGGTTCGGCATGAACGAGCACATGGCGGGCTTTGTCGTTGACA
GTCTTCTATGCTGGACTGAAGGAGATGGCGCTTCAAGTCGTCGCGGACGTACGCGCCAACGCGAGGACGCTACTAGCGGAGCTGGTGCTACTGACTCGTC
TGCAACCAAGCGGCGACGTGAGTAAGACGTCAAAGGAGCTGCTGTAGCGGGACCATATTGGTACCTTCAGCATTAGTCGAACTTTGCCTTGGATAGCAGG
ATAGGAATTTATCTACAAAAATGCAGCTTGTCAACTGTGTCCACTTTTCCATAAGTGGAGTCCAAAAAAAATAAACACTTCCGAGTAAACGCCAAAAAGG
CTTGCTCCGTTTGAATAATGCATATGAACAAAACTAAATGGCGCAACGCTACTCCGAGGATCTAGTTGGACAGCGGGTTCGTGGTCGGGAACTTGGGGTA
GACGCGCTTATATAGGTGGAGGCACACAGTATCGTGCTGCTTGATGGGCTTGTTGAAGACGGCCTTCAGGTCGCCGTGCGTACCCAGAGACTCCTTGATG
TGGCCTGTCAGGCCGTGCTTGGTCGCAAGCTCCACGGGCCTGAACCACCGAATGTCCTCCGGCGAGTGAAACATGTAGCGCACCACCGCCTTGCGCTTCT
TCACCTTCACCGGCGTACCCGTGACGATCACACGCTTGAGCACGACGCGGTTGGGATTCACATTCTTCAGAGTACCGGACGCCACAAGCTGGCCATCCGG
CTTAAAGAGCAGCAGGGATGCAGGCTGGAACGTCACGGGGCCGTACACAGTGGCCACACTCCAGCCGCCCTGGGGCAGGAATCGCTGGAACAGGTGCTGG
TCGCTCTTGAGACTCTGGTCGCTGAAAACAGGCTTGCCGGAGAACCGGCGGAAACCGCAGTGGAAAGACAGCTCGTCCTTAGACTTGAGCGGTTCACCAG
CGAATGACGCAGCGCGCTGCACC