Description :
From Genome Similarity Track
Location :
Scaffold_297:22756- 30314
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_297-snap-gene-0.12Transmembrane protein

Sequence
7558 bases(100 bases per row)
TGATTCCAGAGTACGAGGCTCCTCAGACATCCGAAGATGGCAGCGGTCTTTCAAGACCTCTCGGGAAGATCAAGTACAACGCTGCGTCTCCCGATGAGCA
GGCGCTTGTGCTCGCCGCCAGTGACCTCGGCTTTGTGTTGACGGGCCGTGACGGTCCGATCTGCGAGACGATGATTCAGGGCGTGCCAATGTCTTTCGAG
ATCTTGAATGTGCTCGAGTTCAACAGCGACCGCAAGCGCATGTCGATCATCTTCCGCCACCCAGATGGGAGCATCATCTTGTACTGCAAAGGAGCCGATG
ATGTGCTTTTCGATCTACTGTCAAAATCTCAGCCACAAGGTGTCGCGCACGTCACGCGAGGCCACTTGCAAGAGTACGCGTCCGAGGGGCTGCGCACATT
GACGACTGCGATGCGCCGTCTGTCGACTGAGGAGTACGAGCAGTGGAACGCGCTGTATCGTCAGGCAGAGCTTTCGCTCGACAACCGCGCGGCGAAGATC
GCGAAGGTCGCTGCTGTGATTGAAGTCGAGTTGACTCTCTTGGGGGCGACGGCGATCGAAGACCGACTGCAGGAAGGTGTGGAGGAGTGTATCACGTCGC
TTCGCAAGGCAGGGATCAACTTTTGGGTGCTGACCGGCGACAAGAAGGAGACTGCGCTCAGCATCGGCATGTCGTCGCATGTCATTGACGACAACATGGA
TGTAATTGTGCTGGGCCAGCGAGACAAGGCGTCACTCCGAGCCAAGCTGGAAGAGCTCTACGTCGACTTGGTCGATGACAAGTGGGGCTCAGACGAGCAC
TCGTCTGCTGTGAGCGTGCTGTACGAGGCGTTCAAGCGTGTGTTCATGATGGGCTGGGATTTCGCGAAGACGGTGATCTTTGGCCGTGACGAGCAAGCGG
AAGCCCGCAAGAAGCGCAGACGCCAGCCACGTCGAGAGCACGAAGAGGTCGACAACACGCCGTCCAACAGCCAGATCCAGTTCGACGAAGTGTACCCTGC
GTTGAACTCTGACAACGGGTCTGACACGGGAATGGAGTATGGCCACGGCGACCGCCAGTTTGAACCGAAGAGCGATCTGCAGGACGTGAGCGAGGAGTTT
GTGGACGAAGAGCTGGAGTTCGCGATGGTCATCGACGGGAAGACGCTGGCGCTGCTACTCGAAGACGACATCAAGTACCTGTTCCTGTCCGTGGCGACGC
AGTGCAAGTCTGTGATCTGCTGCCGCTGCTCGCCTGCGCAGAAGGCGTCGGTCGTGAAGCTCGTGACGGAGCCGACGTTGATGTTTTCGCCGGGCAACAT
CACGCTGGCGATTGGCGACGGCGCGAATGACGTGCCAATGATCCAAGCGGCGAATGTCGGTGTGGGCATCAGCGGCAAAGAAGGACGTCAAGCCGTGCTC
TCGAGCGACTACTCGTTTGCGGAGTTCCGATTCTTGAAGCGTCTGCTTTTGGTGCACGGCAACTACAGCTACAAGCGCATCTCGAAGCTGATCCTGTTCT
CGTTCATGAAGAACGTGGCACTGTCGCTCTCGAACTTCTTCTTGGCGGTGCAGACGATGTACAGCGGTCTGCTGATGTACTTTGGCATCTGCTTCACGCT
CTACAACGCGCTGTTCACGACCATCCCGATCGTGTTCATCGCCATGTACAACCAGGACGTGTCGCCCGCAGTGCTCATGCAGTACCCGACTCTGTACGTG
AATGGATTGAAGAACCGGTCGTTCAATTGGGTCACGTTCTTCGGCTGGTGTGGGCTCGGCATGTGGCACGCGTACGTGATCTATGCGGTGCCGTTCTTCT
CGAACGGGTTCATCGTGTGGTACTTTGCAAAGGACTCTAACAACGAGTACATGTTTGGGTCACGCGACCTGGGGCTCTGGGCGGACGGCGTCGCCGCGTA
CACGTACTTGATCACTGCGTCGACTGTGCAGGTGGCGCTGATGACGAGCAACTGGACGCGCGCGAACATCCTGTCGACGATCGGCACGCTCATCTTCTAC
TACCTCTTTATGGCGTTCTTCTGCAATTTGTACGGCTGGACGCACAAAGAGTTTTACGAGACGGAGAACGGCTACGGCGTGCTGGGCGAGCTCTTCTCGG
CTGCGTGGTTTTGGTTCGGTCTCGTGCTCGCGGTGATCGCGGCCGTGCTGCCCAACTTCATCGCGAAGGCCGGTCGTGTGCTCTTTTATCCGGAGCCGTC
GCACCTGATGCGCGAATGGAACCGCTTGGCCAAGGGCGAGGACGCGGCGGTGGTGCTGGACTCGCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGTTCTCGCATTTCCCGGGCGAGAGCGACATGGCGATGTCGACGTACCGCACGAGCACTAACAATTTGTCGCAGCGTCAGGCGCCATTCGGCT
CGTTCGTGCAGCAGCAGCAGCGGTCGCCATCCTCATCCTCGACTGCTGACGAATCCATGCCGTCCACCAAACACTCGTCCACGCCCACGCAGCGAGTGAC
ATAAGTAAGGAACTCACTTGAACGACCGCCCGAACGACCAGAGGCTCGAGAGAGATCCTTACGGTTCGGCTTGGTGGTGAAGTGAGTGTATGTCGCTTTG
CTTTGGAATGGACCCATACGGTACCTTCATCATTCCCCTTATATACTAGTATTAACTGAATCAATAGGAGAGTTACATCACTACTCAACTCAGCTCACCA
ATTCAGCGTTTTGCCTGCTATTGTCCAGTTCCGTCGCCTTCTTTCGTCCACCTAGTAGATGCTAAGCTGCGAGACCAGGTACGTCTCGCTGAGCCCTGAC
GGCGCTGCTTGGTCACCGTCAACGTCCTTGCAGAAGATCTCCTCGATGCTGATCCCCTCCGAGAGCTGCGAGTCGATCGCCAGTTGGTCCACGTACTCCT
TGTTGTCGCTGATGGCTGCACACGCAACAAGAGGCAACCAAGTTAGCAGGTTGTTTCAAGTAATCAAAGCTGTCCACGCACACGAAACGCAAGCACAAAC
CAAGGGAACGTACCATACGAGGCGCAGCCGACGATCCACTGCGCGTCGCTGTATTGCTCAGCAGCAGAGATGGATCGCCTGTTGCGTCTCCGCGGCGAAG
ATCCCAAGCCAGCGCCAGCGCCCCCACCCAACAGCGCCTCGCGCTTCTCCAGCACCTGGCGAAACTTCTCGCGGAGAGCGCTCTTGACACGCGGATCCGT
CGCTTTCTCGCGCAAGATCGGGGTGGGGATCGCGTCAAAGTAGTTGGGGATGCCCTTCGCGGCACGGGACTTCTGCATCAGCCGCGTGAGCATCGGACAG
AAGCTCTGCAACACCGAGGGAAAGTACTCGAAGAGCACGATCTTCACGAGCACGATGAGGCAGAACGCGACGAAGAAGCCGAAGAGCACCACGACCTGCG
GCCGCGTGATGCGCGTCCAGATCTCGCCACGAACTTCGTCGAAGGTCGGGATGTCCTCGCCAATTTCGCTCGTGTCGGTCATGAGCTCGCTCGCAATGTC
CCCAGGCTGTTGGATCAAGCGAGAAACATCAGGCAAAGCTGTGTGATCAGCAACACGAACTCAAAGCCACGGGAGTGCGACGACAAAGTGGTGGGTTGTC
TTACCGATTGGAAGATGAGCTCGTTCGAGAACATCCAGATCGCGATCACCGAGTGGAGCAGCACCGCGTACGGTAGCAGTGACCCGGCCGCACTCGCCAC
TTTGCTGTCGTACAACGGCGGCGATCGAGCAATGCGGAGGAACGCTAAGGAGTTCAGACACAATAAGCAAGAGGGAGCCAGTGTATCTGTTAAGCTCACC
GAGTAAGCATCAATAAGTGGAGGAAACTGGTGCGTACTGAATTTGTCGGCCCAGTACGTCATGAGCATCGCGAAGAAGCCCACGAGATGCAGCAGCGGCA
TCCCAGCGGAGAACTACTGGGCGGAGAACCAACCGTTTCCATACACACTCAAGTTAGCGATTCTGCCTCGACAAGCAACACACTCGAAGCAACACACTCG
AAGCAACACAGACGGCAACACAAGACCTCAACTCACCAGGTAGATGATGAAAATGGACGTGAGCGTCTGCGCATATCTTGCAGCTAGGTCGAACTTGGGG
CCGCGGTAGAGCGCGTCCAGGTCGCGCTGCGTGTCCTGCCTCGTGCGCGCAAAGTTGAACGAGAAGCCGCGGTCGTAGAACCGCTGCGCCTCGAGTGCCA
GGTAGTTGACCACCGCGTACACGTGCGGACTGAACGTGTTGATGATCATCGTGAGCATGAGCGCCACGCCGACGTCGTTGTACCACGCCGGCGTGAAGTC
GCTGTACTTGCCGTTAAGGATCGGCAGTGAGCTAAGCTCAAAGTCGGCGTGGTCGAGAAAGTAGCCGAGGTTCGCGTTGATCACGACCATGAGCACTGCC
GTGTTGCAGAACTGTGCGAGGAAGACCTTGATGACGCGCGAGACCACTTGGCTCGACTCGGTGTGGTGCTTCTCCATGCCCACGAGCACGTTGAGGATCT
TGGCGAGCAACATGTTGATGAACACGACCACGAGCACCGAGAGAAATGAGAGGAACTGCGTCGTCACGTACGACGTGGCCCAGGTCTTGCAGTAGAACGC
TTCCGTTGGTGGTGACGCTTCACCCGAGTCAGAAGAGGAGGACAAGGGGATAAGGAATGGCTCCTTGGTCATGGAGTGGAAGGACTTGGTCGCCAGCACG
GTCTTGCAGTAGCACTCAACGAGCGCCTTATACGGCACGAGGCCAGTCTTCTTCTCAAGCTCGTCCTGGATCACGTCGTCCTTCGTGACTCCCGTGGGAC
AGCTTGTGGGTCGTCCGAATTCGCGCTCGAGCTTGGTCTTTTGCAGCTTGGCGAGGAATATCAGGATGAAGCTCATGAATAGCACTGCGAGCGTGATGAG
CGCGACAACCTATCCACATGGACACGGCATTACCAACACACACAATTGGACAACATGTTCAGCACCCAACAATACGAAAATGTCCACCACAGGTAGACAC
TCTCTTGAATATCTGGAAGTACTTACCAGTTGCCGAAGCAAGCGGCTCCAGTACGGGTAGTGGAGGTTCTCCCAGACAATGTCGGTTGGGTCCGGCGCGG
GCCGGAAGCGCAGGCGCTTGCCCCGCAGGCGCTTGTAGCGCGACTGGAAGAGTCGGTAGATGAAACCCAGGTCCGGGTACTCGGCGAGGCACCGATGAAA
CCCCTCTTCCTCTTTGAATGTGATGAACGCTGTCACCGCCTGGGTCAACGCGCGCTTCTTGCGACTGGCGTTCCAGCGGTCGAGGCGCGCGTTGTGGTGC
ATGAGCTTGTTCTCGAGCCGCTTGATGCGCTTCTCGTGGTGTCTGCGGCGCTTTTCAAACACTTTTTGCGAGAGCCGTCCGTAGAGCACGCGCAACTTTT
CGTACCGCTGCAGCGCGACGTCGAGGCGGCGGACGACCACGCCCCGATTGCGTAGCAGCTCGAGGTGGCCCGACGTATTCATGCCGAACTGGATGTCAGC
GATGCGGATGCGGTCCAAGTCTTTGGTGTATCGTGGTGCCTCGCTCAGCACTTTCTCGAGATGCGCGCGGATCTGAGAGATTGAGATTGAGAGAGAGAGA
GAGAGAGAGAGAGGTAAGGAAACACGAGAGAGGCTGGCAAGATTGAGTGAGTGGTAGCGATGGGTACATACCTCTTCACGGAGCTTGCTGACGTTCTTGT
GGTTCGGCAGGTGCACGAGCTGCACGGTGTAGTCGAGCGCCTTGATCTGGTCCTTCGTGATGCGCGCGACGTTCTCCTGCTCCTTGCGCTTCATCCAGAT
CACGATGAAGAAGAAGCACATGCTGCACGCGATGTCGCAACCGATCGCCAGACCCAGGAAGTCCTGGCGCTATATACACACAGAGAACAAGATCGAGTAA
ACACACGGGTTAGTCTTCATCGTTTACCAACTTTGCCATCGAAAGCAACAATAGCAAACACAACTCACGCTGATGGAGTCCCAGCCGACGATCTTGAGGC
TCCACTCGTTCGACAGGTCTATGCGCGTCGTGAAGCAGCGCGCGTAGACGATCAGGCTGCGCTTGCTGTCGCTTGAGCACTGCGTGTAGTTGCTCTCATC
GTTGATGCGGACGCTACACGTCGCGCCTGGGGTTCGGTCGTCCTCTTCATGGAGACAGAACGTCTCGTACATCCCGTCGACTTTCCACTCGTACGTGAGC
TCTTCGTTCACGTTCATCGTGCAGCTGCTCTTGCCCAGACAGAGCCCATTGACGATCGTCTGGATCGCGCCTGATTCGCAACCGGCAGTGGATCGGATGC
GCATGTCGTCAAAGTTGGCGGCCTTCGTCTTGGCATCCAGGGTTTTGGCGCAACAGGACCACTTCGAGACCGGGTGTACCCCCAGGAAGCAACCATAGCC
GTCCTGTGGACAGACCTGCGTGCAGGCATTTGAAGAAGATGATGAAGTAGTATTTGAAGACGAGCAAGAGATCACAGGTTTGCCCCGACATTTTCCTGAA
CCGGCCGCGACATTGTTGATCTCAGGACAGCCGCAGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCCGATCTCGCCTGCAGG
ACATGTGAGCGACAGTGTGTTGCCCTCCAGCACCTGCTCGCAGAGACTGCTTGATTCCTTCAGGTGCCCGATGCTCGTCATGCCCAGGATCATCGGCAGG
TTCTGCCGCGCGAGCATCTTGAACTCGGTGAGCGAGCCTTTGCCGCCGACGATGTAGATCACGAGCGCGGGCGCGCTGAGTAGCACGAGCAAGAAGAAGA
GCCACGTCATGACCTTGAGGTACTTGAAGTAGAGTGTCATACCCACGCCGTATTGGCTGAGCACGAACGAGTCTGTGGGCAGTCGGTGGAACGCGTGCGC
GCCAAAGTCCGTGCCCAGCGGGTATTTTTGCGGCTTGGGGTTCCCAAACGCGTCAAACTCCGTGGTCGAGTACCGCATCGGATGCGTTTGCCCACGGTCG
TGGAGCACTTTGGCGTACGAGAGGTACTTGAGCTCCTCGGAGCCGCAGTCTGGAGGGTACCCGCCCAGCTGCGGGTCATGGCGCGGCGACATTGGCGTTG
GTATGGACGTCGGTGTGGACAGTGGTTCTTCATTGCTGATGTCGATTGCAAACGAGCGATGCGATGGCTTCTCGCCTGACGCACTACCAGTAGCACCAGG
CGCTGCTTGAGCTCTGGTCACAGGATTGCTGCTGGGAATCGGGATGCTCGAGCTAGTGGAACTCGGTGGCGTGTTGCCCGTTCCCACAAGCGACGCAACC
TCGCCGGCGCGACACTCTTCTCTTGGGATATCAATAGGAGGAGCTCGCGCATGGCTTCGGTTGCCGCCCTGACTCAACGACGCGTTTGCTGTAGAAGGCG
AAGCTCGGTGCTTGGATTTTCGCCTCGCCATTGCCAGAAGGTGAACGAGCGGGAGGGCGATGCAATCTCGCGTTCTACTTTTCCAGGTCAATCAGATGTG
GCCACCCTGTGAAAGAAAGGAGCGTTGGACTTCTGTCCGCCCACGAAAGGTTGCGAGA