Description :
From Genome Similarity Track
Location :
Scaffold_398:22753- 23815
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_398-fgenesh-gene-0.10Conserved gene of unknown function

Sequence
1062 bases(100 bases per row)
AGCAAATTGAACGAACTCGTGGATGCAACGGAGAAGAGTGCCGAGGCCAACGAGACTGCGAAAACGGAAGAAGGCGCCAACAATGGCGACTGGAAGGGAC
CGTCGACCAATTACCACTTGAAACAGTTGGGCCTTACTGCTAAGAAGATCGATATTTATGCGCCTGTCGAAGTGCAGCAACAAGAACTTCGTCGTCTTCG
TGATCGTTCTCGCTATGGACAAACACTGAAGCTTACTGACCCTATCGACGACCACGATTCGGAGAACGATTCGGACTTTGTACCAGAAGAAGCCACCGAC
GAAAATGACGCCGATGAAGATTCCGATGCCGAGTCGATCCCTGAGGTCGATGCCGACGAAACGCAGCAGCTTGTCCAGGAAGCCGCCGAACACGAGCAAA
AGCTTCGTCGACGCGCGCAGTTGGTACGCATCCCAGTGTACATCATCCTGTTCTGCATAGTTGCTATCGCTTCGCTTGCAGCGGTGGAGTTCACGCAGCG
ACACTACACGATCTGTCCGTTGGACGCGCAGTCCGTTGGTAAGTTGTCATTTACAGTTGCAATGCGGGCATCGTTCAGTTGCTAATGACGCTTTGTGGAT
GCACGCTTCTTTTAAACAGAAACTGACGACCGCACGATGAGTTGCGCTTCGTTCCTGCATGCGCGTGCGACCGCGACAGCGTTTGTGCAGGATTCGGTTG
CTGCGGCCACCGCGTTTGCGCAGGAGACAGCAGCGTCGATTCGATCGGGCTTTGAAGAGCTGTAGGACAGCAAGGAGGTGGTGAATTTATTGTATCTTTA
GTCAGTAGGGAACCCATGCACGTGCATATTTGGTAAGGATAGGAATATAACGCTAGGAAAGAGCCATTGAGTTGCATTTTCGATTTGACTCCGTGGACGA
ATGGCTGCTTGTTAAGAACGTGTTCCGTTAAGAAACGCAATGCCTCATACTGTGAGGTTAAAACAAACACCAGGTGCCAAAATCCTCTATAAACAGCATA
CTCTATTCAACTACCTTCTGCAGAAGATGAGGGAATTTTATTCTACAGTGCTGGTCAGTGCT