Description :
From Genome Similarity Track
Location :
contig_136:22750- 24243
Transcript NameFunction/comments
g14209.t1hypothetical protein

Sequence
1493 bases(100 bases per row)
TTCTGGCAGAGGTGGGGTCATGACTCACCAATGCTCTGCCAGAAGCTGGGTGCCGGTTAGCCTCGATGGCTTTCCGACACCAATTGCTTCAGGGTGCGTG
CGTCCTTAACACGGCGTACCCAAGCGGACGCCGTACGTGTCCACGACCACGTACGGGTTGCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCTATGC
AGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGCGGCGTACGAAAGCATTCGACGCCCCTGGAACTAAACGTTCCTAGGGATATTAA
CATCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGCCATCACCGATTCGAGACATAATGTCTCTCGTAGGCTAAGCCTCCATGGTGTGCGTCA
CCCGCACACCCGTCACGAAGACTCAACTCTCCCCCCTCTGGGGAACCCGCCATTACTGGTGGCCGGAGTTCCCTCGGCCACCTGGCCGCGGCTTGCGCCA
GCGACCGTTAGGCCCTCGGGGTTTGAGGGATGGTTCTTCCCCACCCCAGTCGAAGGACACACACGTTAGTAGTGTCCTAGTCCGCCGCATTTATAGCAGT
GGACCGAGCCAAGCTCAGCAGAGCTCAACTTCATAGGCTCTGACTCGTTGTTCGCAACGACAAGTTGCACAACAACCGGAGTACCAGCCTGCTTATGGCT
GTACTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGATGCATGCACGCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCCACCGTCG
TCTTGACGTCTTCGGGCAGGGGGTTCCCCACCAACGATGATGCTAACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCGCTTCCCTTGCTTACAGGC
GAGGAAGCGTGAGCGCTGGCGGAACGTATCGTTCGCCGGGAGAAAAGCAGCGCGAAGCCGCTCGTACAACTGTTCCCAGTATGCAAAGCATCCAGGAGAC
GTCGTCTCCAGCGTGTACGCCCAATTCTTGGCACGACCGCTTAGGTTGGACAACGCGAACGCAACGCGAAGTCCCTGATCCGAGATGAGACCCGCCCTCA
TGTCGATCTCAACTTCTCGGATCCAGAAGTGAAGGTTTTCACCTTCCTTCCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGCTTCGGCTGGACCGGCTT
CGGCTCGGCCACAGAGGCCTGCAGGTTCCCTGCACGTGAGCAATGAGCTCACGCTCATACGTGTCGAACGCGTGAACGCGTTCGACTTGCTCGGCTGGCG
TCACCGACGCCAAGCCTCGGAGGACATCCCTCCCAAAGATGCCTCCTATCTTTCGAACGGACTCGAACTGCGAGTCGTTCAAGTGAGGAAACTCACTTCG
TTCCATAGTGGCTCAGGCTTTGAGACCACAGAGGATTCAGGTAGTCCAATCCTACCCGCGTAGGCGTGGATTGACTACAAGTGCTACCAAGTG