Description :
From Genome Similarity Track
Location :
scaffold_464:22747- 26393
Transcript NameFunction/comments
g8587.t1 conserved hypothetical protein

Sequence
3646 bases(100 bases per row)
TACATTGCGCTCTAAACGGCGATCGTTCCGACCAAGCTCGAACAGCTCCAGTCGAGACATTTATGGCTGAAGGGTTCGAGCGCTTACTTATGCAAGAAGC
TCTCGTTGTGATAGCCAAAGATCCGCCATTTAGAGAAGTTCGGTCTCAATTGACCAGTCTGCTCAAGAACATCAGAGAAAATCAACCTCACTGCTGAAGG
AGATTGAGCTCTATCGGCGATTGAGTTTGAGGATGTGGTACAGTTTGTGATGAATGACTATCCGCGGGGCTACTTTTCAAGTGCAGCAGCGACGGTCGAC
TGGCCGCTTCAACGCTGCAGGCTTGGTTTATCGTCCCTTGGTGGCTGCGTATGCTCATGGCTTCAGCTGCACGAGGCTGTTGGGCGAGTCTCCCTTCTTC
GCTCTCAAATGTGACCAGCACATATTCCCATGGAGCCACCAGGCGTGACTAAAACTTCGATTTGGTAGTATTGCTTTTATATCCCCCTCCTTGACGGCAC
GCAACTACCGAGCACCTGCCGAACGAGTCGGCACCGCTGGCATTTTTATCTGAAAGCAGGGGACCCACTCGCCTTTGCCTGCGGAGTTCCACGAGCGGAG
CATAACGTCATAGATTGCGTTGAGCTGCAGCCCTTCCACCAGCGCAGTCTGCTGACGAGACTTGCGGTTGTGGGCTACGCGCTCGGAACGCCACGTGTCG
ATGCTGCTATCTGCCTCCGGTTTCTTCTGCTTCTCATTTTCCTCGTCATCCGGACTTCAGTCAGCCGTCGATATCGCAGCTCGTACTTGTCGATGATGGC
GCCATTGGACATCGGAGTCTGCCACGACGCTCGGAGGAGGCACTTGTACACTGTTTGCTGCATCGACCCATTGTCTACAGACCCTGATCGAGTGAGAACC
ACTTCAGACGAGTAGCAACTGGAGAAAGAGACGTCACACGTCGGTGGCGATGGAAGTGCTGGGGGTTCGTCCAGCAGTCGAATGCACGTCGCACTGTCAG
CAACAATCGCTTTGGAGTCTCGACGTCTGTCCGGCAGGGCTGCATGGGCACAACACTCGCCAACCACCTGCAGTGGAGTCTGACGGTCTAGCGGAGCTTG
AGGCCGAGTTGCAAGCTGGACTCTAACTTGGCAAGACCGACAATAGCTCCGTGCGTTACAACCTGAAGAATAAAACTCGTGGCGAAGGCAGATGATGTCA
CGAACGAGGGAAGTGTCGACCTCGCGCGGCGTGCGGAGCTCTTCAGGGCTCTGATAACCGGATACGTGTTCAGTAAGTCTGTTTCAGTGCAGTATTTGAC
TTCAAGATGTAATCATTCTCACTTGGGTTGGTGTTTATTTGTATCTTTCCTGCAGCGTGTTGTTCTAGTACACATTGAGGTGATCTCAGCTCCGTTCATA
GCGGCAATGCCGGCCCGGACGCTGCAGTGGGAAGGTATGCACTGGTGGATGCTGCAAAACGCGACCCCTGTGTTCGTGGCGAGTGCCTATTCACGCCCAG
ATCTCGTGCGCTGGCTGCTTCTCAATGGCACAGACCGTTCAACTTCGTGCTGTCAGATCAACAATTATTTCTGGGGTAAAGTTTTTTTATTTGTCTTAGC
GTATTTTATTGGCAATTTTACGCATGACAGATCTTTACGCCCATCATTGCACGGAGTTTTTCAAAGTGGCCTTGGCTTAGTGGCTTTGTGAGAGCATCTG
CTATCTTATCGTTAGTATTACAATAGGTAACACTGATACTTTTCTCTTCATGCTTATCACGGGCATATAGATGCCTGATATCAATGTGCTTTGTCGAGGA
GTGACTGCACGGATCCTTTATTATACTAATAGCAGCTGTATTATCACACCAGCATTGAGTTGGTAATATTTGACCAAAACCTAACTCATTCAGTAGTAGT
CGTAACCACATTGCCTCTCTTACTCCTTCACTGGCGGCTATTAGTTCTGATTCCGCTGTGTGTAGACTTATGCAATCTTGCTTAACACTCTTCCAAGTAA
TACAAGCACCAGCAAGTAATGATACATAACCTGTAATAGATTTTCTTTGTTCATTTGCATTCGCGAAGCTCGCGTCTGTGTATAGCTCTACCTTAATAGT
ACTATTACCATTGTACTCTAAGCCATACTTCGACGTTCCTTTCAAGTACTTTAGAACTCGCTGAGCCGCTCTCCAATGTGTATTATTGTAGCAAGATAAG
TATTTACTAAGCTCCCTTACAGCGTTAGCAATGTCAGGTCTAGTGCCTCGAACGAGATACATTAGAGACCCTACTAATCCTCTATAATCATAGGGCTGTG
CCGCTATTTGCTCAGGAGTTAGAGACTCTTCCTTTTCTAAAACCACGCTCTTGGCTTGTGGTGTAGACACAGTAGTACAGTCGCGCATTTGATACTTTTC
CAAGATATCATTGATCTATTTCTGTTGCGATAAACACAGTGTCTTTCTTTTAAGGTCTCTTTTAATCTCCATTTTAAGCAAGTAGTGAAGTTTACCTAAG
TCCTTCATAGTGAACTTAGCAGACAATTTTGCTTTGATATCCTTAATAGAGCTCCGATGTGAGCCCGCAATGGTAAGATCGTCTACGTATACGCAAACTA
TGAGCGTGTGTTTGACTCCTTCAACCTCCCACCTTTTTAGATACAAGCAATGTTCTTTCTTGCATCTAGAAAAGCCTAAATCATTTAGAAAGGCATTAAT
TACTTCATACCAGATTCTGGGAGCCTGTTTAAGGCCATATAGACTTTTCTGTAGCTTACAAACTAAATTGCCATCTCCGTGACGGAATCCTAGTGGCTGC
CTCATATAGATGGTCTGACTTAGGACGCCGTTTAAAAAGGCCGTTGATACATCCATTTGGTGCATGTGCAAATCTAGGATGGTTGCTAGAGCCAAGAGTA
GACGCAAAGATTCGTAGCGTGCTACAGGGGCAAAAACCTCTTTATAGTCGATACCATACATCTGCGTGTTTCCTTGGACTACAAGTCTAGCCTTAAACCG
GTCAACTGAGCCGTCAGCCGTGTACTTAACGTCAAATAACCTGTGGCAACCGAGGGGTTTTCTGCCTTCCGGTAGACGTACTAATTTCCACGTGTTATTC
GCTAAAAGAGCCTCATACTTAGTCTTTATTGCACACTCCCACTGCTTAGCATGTTCACTAGCTCGTGCTTCCTTTATTGAGCGTGGAATTGAAATGCGTA
TATTACCCATTGCAACGTTATTTAAAGGTGTAATATAATCTGTCAATCTGACGTTACGTGTTCTTTGTCGCTTTGATCTCCGTCTGTCACTGACTCCATT
TTCAACTCCCACTATTGGGGATGTCGGAGGGCGTGTGACAGATGTTGAAGTTGTATCTTCAATTTCGGTGGTCGATTCAGCTTCAACTTCTGGTCTGGAT
CGTTTTCCTAAGTTCTGAATAACCCTCTCTTCATTCAGATCTACACTACTATTTTCAGCAGGGAAAGATCTTTGTATCATAGCCTCTGTACTTATTGAAC
TGAATTTCACGTCACGAGCTATGAGGTACTTGTTCGCTTTGACGTCTAGCAGTCGATACCCCTTATATTTGGGTGTCAGGCCCAAAAGTTTACACTCTAT
CGCTCGATCACCGAGTTTTGGGTCCTTTCTCTTGGATTTGGGTACA