Description :
From Genome Similarity Track
Location :
contig_57:227449- 231101
Transcript NameFunction/comments
g8925.t1hypothetical protein

Sequence
3652 bases(100 bases per row)
ACCTGCTTCTTTCAAGTTTGTCAAGCTGTACCGCTTCGCCACAGCTTTTGACAAGGTGCTGCTGACGGTTGGCATTATCACGACGGGGGCCAACGGCGCA
CTGTTTCCTTTGATGGCCATTGTTTTCGGCAACGCGCTGACGGGATTCGCTTCCACGCCAGTGGACATGGACTCGGTGAACAGCGCATCGCTCGACTATT
TGTACATCGCCATCTTCATGTTCTTCACAGATTACGTTTCGTACGTGGCGTTCTACTACAGTGCGGAGAGGCAGATGAAGGCCTTGAGGGTGAGGCTCTC
AACACATGCTGTACATGGACATCAGCTGGTATGACAAGCATGACGCACTGCAGTTGTCGAGTCGGTTAACGGGAGACACGGTGAGAATCAAAGATGGCAT
GGGCCATAAGCTCGGCTACGCAATCCGGTACATGATTCAGTTCATTGTGGGCTTCATCATTGGCTTTGCGCGTGGCTGGGATATCACGTTGGTGATGGCG
TGCGTTATGCCTATCATGGCCATCTCGCTCAGCTGGCTGATTAAGACAATGACAATCATGGCGGAGTTTGCACAGAAGGTGTATGCTGAGGCTGGTTCAG
TCGCAGAGGAGACACTGGGATCGATGCGAACGGTGGCGTCTCTGAACAGTGAACACAAAGCGATTCAGAAGTTTGAGAAGAAGGTGTTTGAGGCGGAGAA
GGAGAATATCGCACTGCACAAGATGTCGGCTGTCGTATTCTCGCTGTTCATAGCAAGTATCTACGTTATGTATTCGGCCGGTCTGTGGTATGGGGGATGG
AAAGCTTCGAAGGAAACACTACACCTGGAGACGTGTTCGCCGCCTTCTTCGGTGTTATGATGGGATCGACTTCGCTTGGCCAGATTTCGCCTAATATCAC
TGCTGTCTCCAAGGCTGCCGGCGCGTGAAGAACTCTTCGCTATCCTCGACACTGCCAGTGTCATTGACGCAGAGAAGGAGGGCGAAGGCGTCATCCCTGA
CTCCTGAAGGCAAAATTGAAGCCGTGAATGTCAACTTCACGTACCCGAGCCGTCCCGAGGCGCAGATCCTGCGTGACTACAACGTCACCATTGAACCCGG
CCAGACGGTGGCGTTCGCGGGTGCTAGTGGCGGCGGCAAGAGCACTCTCATCGCGCTGATCGAGCGCTTCTACGACCCCACCAGCGGCACGATCTACCTG
GACGGACGTGACGTGAAGACGTTGAACGTCAAGTGGCTGCGCTCGCAGATCGGCATGGTCTCTCAGGAGCCTGTGCTGTTCGCCACCACCATCTTTGAGA
ACATTGCTATGGGCGGTGACAACGTGACTCGCGACGAGGCCATCGCCGCGTGCAAGCTGTCGAACGCGCACAACTTCATCATGTCGTTGCCGGAGAGCTA
CGATACGTTGGTCGGCGAGAAGGGCGTGTCTCTGTCTGGCGGCCAGAAGCAGCGTGTCGCCATCGCACGTGCCATCGTGCGCAAGCCCAACATTTTGGTG
CTGGACGAGGCCACCAGTGCTCTCGATAACGAAAGCGAGAAGATCGTGCAGGCGGCGCTGAACGACCTCATGGCCACGACGAACATGACGACGTTGGTGA
TCGCCCACCGTCTGAGCACGATCCGTCACGCCGACAAGATTGTGGTTCTGAACGAGGGTCACATTGTGGAGAGCGGGACGCACGACGAGTTGCTACAGAT
CGAGCACGGCATTTACCAGAACATGTATCGTATCCAGGAGCTACGCTCTCATGAGGAGCAGCAGGAGGCCGAGAAGCGCGAGGCGGAGAACGATCTTTCG
GGTACGAAGTTGTCTCGTTCGTGAGTGCTGTGTCGGCGAAGACGGACATTTCTGTGAGCGAGGTGGAGAAGAACTTCCTGGACAAGAAGCCGTTTGGCTC
ACAGATATATTGAAGCTCAACAGATTGGAAGCGAAATACTTCGCTATCGGGATGATCGGGACGGGCGTGGGAGGGATCGTCATGCCAGCGTCTGCACTAC
TGACCACAGGAATGATCATCCATGACGGAACAGTATGGGCTGTACCAAAGGTCTGGCGAAAGATCCCATCTGGCCACAATGTACAACGATGTGAAGCTGT
ACGGGATCCTCTTCCTCGTTGCTGCTGCGGTGATCGGGATTTTCATGTACATGCAGATCTATTGCTTCAAGTTCATGGAGGAGAAAGTCACCACGCACTT
ACGTACGGCGAATTTTAGGGGCTTGTGCCGTCAGAATGTTGGCTTTTTCGATGAGAAGGAGAACGCTACGGGTGCATTGACTGCCGACCTTGCCACGAAC
GCTACGAAGGTGTCCCTGCTGTCTGGAGAATCGCAATCCGGTGCTTTCCAGGCGGTGTTCACCTTAATTGCTGCTCTCGTCATCTCGTTCGGCTTCGGCA
GTTGGCTACTCACGTTGATCATGGTGGCGCTCATTCCGTTCTTGCTTTTTGGAGAAGTGGCGCGAATGAAAGAGATGGAGACCAGCGGATTGATCTCGGA
TGACTTGGCAACCCTGGTGCTCACGCGTCTGAGGTTCTCAGCAACATTCGCACCGTTGCCGCTCTGGGCATCGAGTACAAATCTGCGAGCGTGTTCGACG
AGCTGCTGCAGGAACCTCTTCGCAAAGGCAAGAAGGAGGCACAGGTCAACGGTCTGTCACTCGGCTTCAGCTCCTTCATCCTAATGGCGACAAACGCGCT
CATTTTCTGGTTCGGCGCCAAGAAAGTGGACGACAACACAATTACCTTCACGGAAATGATGCGAACGATGATGGCAATCATGATGTCCATTCAGATGTCA
GCAGTGGGTCTAATTTCTTACGTGACGCCCAAGGCGTTCAAGGCTGGGTCGACCATCTTCGCCATCCGCGACGAATCGCCCCAATCGACTCGTTCAGCAC
CGATGGTCTCCGTTGGCTAAGATTGAGGGTCGACTCGAATTCAAGGACATCTCGTTCCGGTACCCGACGCGTCCCGAGATGAACGTGCTCAAGAACTACA
ACCTCACCGTGGAAGCAGGCCAAACAGTTGCATTCTGTGGCCCGAGCGGCGGCGGAAGAGCACTATCATCTCGCTGATCGAGCGCTTCTACGACCCTGTA
GTCGGTGAGGTGCTGCTCGATGGCCACAATATCAAAGACCTGAACCTGAACTGGCTGCGCAGATCGGACTGGTCGGACAGGAGCCCACACTCTTCATCGG
CACCATCGCCGACAACATCGCGTACGGTCTGGCAGAGCAGCCTAGTCAGCAGGAGATCGAAGAGGCCGCCAAGATGGCCAACGCACACGACTTCATCACG
CAGTTCCCGGACGGCTACGCGACCCAAGTGGGGATGAAGGGCGAGCAGCTGTCGGGCGGTCAGAAGCAGCGTATCGCCATCGCGCGAGCCATCCTCAAGA
ACCCCAACATCTTGCTGCTGGACGAAGCCACGAGCGCACTGGACTCGGAGAGCGAGAAGTGGTGCAGGAGGCGCTGGACAAGGTGGTGGCGTTGAAGCGG
CGCACGACGATCGTCATTGCTCACCGGTTGTCTACGATTCGTCACGCTGACAAGATCTGCGTGGTGAGCGGTGGCAAGATCGCGGAGCAGGGCACGCACC
AGGAACTGATCCAGCTCAATGGTATCTACGCGGGTCTGATAGAGTCGGCGTC