Description :
From Genome Similarity Track
Location :
Scaffold_330:22744- 25544
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_330-snap-gene-0.12ATPase, aminophospholipid transporter

Sequence
2800 bases(100 bases per row)
ACGTCAGTCTACACTGCATACAATTTTGTGCCCAAGAACCTGTTCAAGCAGTTCACTCGGTTCTCGAACGTCTACTTCCTGTTTATCACGGCGCTGCAGC
TGCTCCCAGACGTGACTTCATCCGGTGGAGTGCCAACAATGGTTATCCCGCTGTTTTTCATCATGGTGGTGAGTGGAGTGCGGGATCTCGTGGAAGATCT
TCAGCGTCATCGAGCTGACAACCAACAGAATCTCGCACCAGTGAACAAACTGTACTTCCCTGGAACCCACTTTACTGAAGCAACATGCGCGGACTTGAAA
GTGGGTGAGCTTGTCCACGTTACGCAGAATGAGGCGATCCCGGCAGACATCGTGATCATCGCAACAAGTAACAGTACGAATGGTCAGTGCTACGTCACGA
CTGCGAATCTGGACGGAGAGTCTTCGCTGAAGCCTCGCTACGCGCATCCAGAACTGTGCAAGTCCGTGCACGCTATACCGTTCTCTCCTGACGGAAAGCG
ACTCGATGTAGACGTCATCAACAATCTCAGTGGAATCAAGCTGGAGTGCGAGCCTCCAAATCGGCGCATTGACAAGTTCAAAGGCTCAGTATTGTTTCCC
AGTGGCCAAGTCTCCGAGCTGGATATCTCCCACATCCTGCTCCGTGGTACGCATCTCAAGGACACAAACTGGATTGTTGGCAGCGTGATCTACACCGGCG
ATGACACCCGAGTCCGCCAGAACTCCTCCAATACCCCCGTCAAGATGAGCTGGCTGTACAAGTTCATCAACAAGATCACGCTGTGGGTGGTGTTGGCGCA
GATTGTGATCCTCGTCGTGGCTGTGCTGATCGAGAAGCACTTGGTGAGCTCGAGCAGTATTCAGAACAACCCGTACATTGCGGACGTTACGAAAGATGCG
AGTACGGTCGACTACATGTGGCTGTTTCTCGCCTACATGCTGCTGTTTTCGAACTTTGTGCCGATCTCGCTGCAGGTCACGATCGACTTCACGCACTACT
TTCAGTCGCTTGTGATCACAAGCGATAGAGAGATGCGAGTGAGCTCGGATTCGTTTGCTGCCGACGCCAAAACCACAGACAAGAAGCATGTCGTGCAAGT
GCAATCATCAGAGCTCAATGAAGAGCTTGGCATGGTTGAACACATCTTCACTGACAAGACAGGGACACTGACTTGCAATCGGATGGAGTTCCGTACTTGC
CACGTAGACGGAAGGACCTACAGCTACCATGGCTCGGATGGAACGCTTCGACAGATCGAGCAATCGCCGCGATCCCCTCGTCTTGATCTGTCTACCTCAT
CGAAGGATGTTCTCGTGGTGCAGAAGTTCCCGCAGGTTCACCGGTTCTTCGTGAATCTCGCCGTGAATAACTCCATTTTTCCTGCCGTTGCCTCGTCTTC
CCCCTCAACAGGAGATCCAATTCTCGAATACTCGGGGCCATCACCGGACGAACGCGCACTCGTAATGGCTGCTGCTCGAGCTGGAATCGAGCTTCGGCGG
CGAGACAATACCCACATCTTCCTGCGCGTCTACGGAGAAGAGGTCGAGTATAAGATCCTTCACCTGTTCGAATTTACAAGCGACCGCAAGAAGAGCTCTA
TCCTGTGCCGCGAGCGTACTACTGGTCGCCTGATCCTGTTTTGCAAAGGAGCCGACTCCGTCATTTTAGGATCATTGAGTGACCGCAACCACGGCGGGAA
AGTGATCCAGGCGAAAGAGCAGATGCAGGCGTACAGCTCCAGCGGTCTCCGTGTTCTCTGCATTGCCGAGCGACAGATCTCTGAGCAAGAGTACCAATTG
TGGCACGAAAAGTTCATCGCTGCGCGGAGTAGCGCAAACAAAGAAGACTCAGAGGAAGATGTGGATCGCGTCATCAGCGAACTGGAACAGCAACTCATGT
TCGTCGGTGTTTCCGGCATCGAAGATAAAATCCAGGAAGGCGCTCCCGAGTGCCTTGAAAAGCTCCGTGCTGCTGGGATCAAAGTATGGATGCTGACTGG
GGACCGACCAGATACGGCAACAAATGTGGCGTACTCGGTCCGACTAGTGTCGAGCAAAATGAAGCTGATCAAGCTCATCGATAACCGATTGCTTGAATCG
AAGACAACAGCGATTGAGTTTCTGCAGAGAGAGTTGACGAATGCACGGAACGACAGCACGCATCAGCCGATGGCGCTTTTACTCAACGACGTGGCAGTCG
AAGCGGCCAAAACTTTTGGTATCGAGAGTGAGGTCCTCTCGCTCTGCATGCTTTGCGAATCCGTGCTCTGTGCACGCATCAGCCCCAAGCAGAAAGAGTT
CATCGTCGAGATGGTGCGCCATTTCTTTCCTACAAAGATCACCATGGCGGTGGGCGACGGTGCAAACGATGTGCCGATGATCCAGCGCGCTCACATCGGC
GTGGGTATCGCTGGTGAAGAAGGACAACAGGCATCCGATGCAAGCGACTACTCGATCCCGATGTTCAAGCATCTGCAGCGACTCATTCTTGTGCACGGCA
GATGGATGAATCGTCGCGTGTCGATCCTCACACTGTACACTTTCTACAAGAACGTGCTGCTCGTGCTCCCGCAGTTCGTCTATGGGTGCTACTGCCTCTA
CTCTGGTCAAAGCACGTACTACGACACGCTACTGCAGCTCTTCAACATTTGCTTCACATCGCTGCCAGTGCTTTGCTTTGCAGTGCTGGACGAAGACATG
TCTGCGCAGACGTCGGTGCTGTACCCAAAGCTCTACCAAGACGGCTTCCTGCACACGTTTTTGAACATCAAGGTGTTCGTGTACTGGATGCTCGAAGCGA