Description :
From Genome Similarity Track
Location :
scaffold_506:22744- 23755
Sequence
1011 bases(100 bases per row)
TTGGCATGTTGACTTAAGTGGGAATGCGGACCTTTTTAAGGCGGATGCATTAATCTCCAAAGATAATATACACCGAGCGACACAGGGAAATAAATAGCCA
TCGAGCACGAAACGAATTTGGGGAAGCAGTAAATAGACTAAGGGAAGGGACGAAGGTTGCAAATCACAGGGCTAGGTTTGATAACGTGGTTGATAACGCG
CGATCCTTGTGACGTGACTGGTAGAGGATAACGTTGCAGCTGCTTCCTTGTGCTTATATCCTGGTCGTGTGTGTCGTACACGCGTGGCTTAGCCTTGCAA
AGGCATCACAAGCTGAACGAAGCTGTTCTCCATCCTCTTACTAAGTTTCAGCCCCGAACACGCTCTGCGTGGAGCGCGATCCTGGCGAGCGTAATAACCC
ATGATCACTCGACTCCCAAAGTTGATAATATCAGCTTCATATATAACATCTACCGTCAGAGGACCCGGCGGCGGTAATATCAACTTATACAGAGGATCTG
GCGACGTACAGTGCCGGCACTATATTTAAGAACGACGGTATTTTCCGATGTTTGACCACTGAAATGGTGTAATTGAGCTGGAAATGCACCAATTAACGCG
TCGTGTAACGACGCGTTGATTGGTGGTCTCCGTGTTGGAATCGGATCAAAATTGACAGAGCACTAGAAAATTACGCTTCCAGGGGGTGGCAAAATATATA
AGAATGAAGGCGTATTTTTCGGTTTTTTACTTGCTTAGTGGCGTTGTTTGAGAACATGCAATATGCAGTTTTACCGCCATTGTTCCACAGAACCGATGCA
CACCGATTTGGCATCGATTCGATGAGTGTGTCGAGGTAAGGCTGATCAATCTTGTCCCATGTCTTTAGAACTGCACGTGAAAGCTCCTTCTTCGTTTCGT
ATTGCTTGCCACCGGGGTAAACCAGTCTTGTTAGCTTCCCCCACACGTTCTCGATGGGGTTTAGATCCGGGGACAGCGCAGGCCAAGGTAGAACAGGAAA
TTCTTGGTCTT