Description :
From Genome Similarity Track
Location :
Scaffold_86:227424- 230152
Sequence
2728 bases(100 bases per row)
TCGAATACATTTCTGCAAACCGTGCGTATTTTGGGCCGCGACTGCTCGATGTTGATCAATTCTGGCGCCTCTCATTGCGTCTGGGCCTCGGGCCGAGGCT
TCGACACGTCCGCAATGTCTACGACGATGTTAGTAGCTCGAGGTTTCGATGGACGTGCTCAGCAGCGTGTCGTACCCATCTCTGATATGGAAGTGACTTG
CGGTGTGTCAGTAGTGCAAGTGCCATTTGTCTTCTGGCCCCTTGAATATGCGTACGATGGTATACTAGGTCGCCCATGGCTGGAGGCCAGCAATCCCAGA
ATCGACTGGCCGTCTCGGTCGCTAACCTGGACCGGCTCAAGTCACGAGTCCCCGAACGACTCACCACCAGCAACACGAGGTGAAGATCAAGCTACTCCCG
TGCTGTCCAAAAGCTCCACGTGTTTGGCTCAGCTTGAAGTCTCTCTTGTTCAAGGAGCGTTTGGTCAACCATGAGTATTTCGAGATATTCCGGCTGGTGC
TAGAGTCAGGTGCACTACCGAAGCCGACACCGCGTGACGTTATTATACTGCTGAACGAGGTTGACGACGTTATTCCATCATCGTTGCCGAGCAAGCTCCC
TCCGGAGCGAAAAATTCAGCATGGCATCGTGCTGAAGCCAGATGCTGCGCCATCATCACACTCGCCATTCCGGCACGCTCGCGTTGAAGAACAAGAGCTG
GCGAAGTTTGTCAAGGAATTGCTCGGCACGAACAACATCGAAGAATTAAAGTCGGCCTGGGTGTCCAACATTTTTGCAATTCCATTGAAGGCGGTTGCGA
CGGGTACAGCACCAACTCGCTCGGAATGGCTTCGCAGCGGTGATGCCAGCATACCCATTCGATGGGTGATCGACTACAGGCACCTCAATTCTCAAAGCGT
CATCCCGAATATTCCAATCCCCCGTGTAGACGATATTTTCGACAAGTTAAGTGGTGCTGCGTACTTTTCGACCCTCGATTTAATGTCTGGCTATCATCAG
ATTCTGCGCGAGCCACGAACGAGAACTGACCGCCTTCCAGGCAAACCGCGAGTTGTACCAATTGGGTCCGCACGCGGGTTGGCCCCCCCCCAAGGGGTAA
TGGCGCCAAAGGCCCGGTTTCAGGTTTCCGCAATCCGTGCTCCCCTCCTGGCCCTCCCCAATTTCAGGTTTGTGGGGGGTTTTATTGGGAAGTAATTTCC
TTTTTTCCCACACCTGGTGGACACATACCATTACGAGTGTATCTTCCGTGAGCCAGTGAGCCGAAGACGTGCGTTGCGACATCATCGTTTCTGGCTCAAT
TCTCTCACGATCCCCTAGATCCAGCCAGGGCTATGCAGCCCCTCGCACCGGAAGAGCTGCAGCGTTTCCTAGGGTTCTGCGGCTATTACCGGCGATTCAA
CCCACCGTACTCGGTGCTGGTGTATCCGCTGACTGACTGGTCAGACTCAGCTGGTTGGCGTGGGGCACCGAGAGATCCAGTTTTGATGGTGTCCGCGCTC
TCTGCAAAATCTCAGTCTGCTCTACCGTGTCCTCTGCATCACTCCACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN