Description :
From Genome Similarity Track
Location :
contig_136:22742- 24236
Transcript NameFunction/comments
g13686.t1hypothetical protein

Sequence
1494 bases(100 bases per row)
TTCTGGCAGAGGTGGGGTCATGACTCACCAATGCTCTGCCAGAAGCTGGGTGCCGGTTAGCCTCGATGGCTTTCCGACACCAATTGCTTCAGGGTGCGTG
CGTCCTTAACACGGCGTACCCAAGCGGACGCCGTACGTGTCCACGACCACGTACGGGTTGCAGCTGTTCAGGTATGTGAACCTGACAGCAAGGTCTATGC
AGACCATTGCCGATGCTCTCTCACAGAGAGTTGGCAATCGCTCCGGCGGCGTACGAAATCATTCGACGCCCCTGGAACTAAACGTTCCTAGGGATATTAA
CATCCCCGTACACTCACGTGTACTAACGGCAACCCAGCGTTGCCATCACCGATTCGAGACATAATGTCTCTCGTAGGCTAAGCCTCCATGGTGTGCGTCA
CCCGCACACCCGTCACGAAGACTCAACTCTCCCCCCTCTGGGGAACCCGCCATTACTGGTGGCCGGAGTTCCCTCGGCCACCTGGCCGCGGCTTGCGCCA
GCGACCGTTAGGCCCTCGGGGTTTGAGGGATGAGTTCTTCCCCACCCCAGTCGAAGGACACACACGTTGGTAGTGTCCTAGTCCGCCGCATTTATAGCAG
CGGACCGAGCCAAGCTCAGCAGAGCTCAAATCCATAGGCTCTGACTCGTTGTTCGCAACGACAAGTTGCACAACAACCGGAGTACCAGCCTGCTTATGGC
TGTACTCCTCCTGGAGGGCGATCTTAATCGCCTCCTCCATAGTGGATGCATGCACGCGGAATAACTGCGTGCGTGCGGGACCGACCTTCAGGCCACCGTC
GTCTTGACGTCTTCGGGCAGGGGGTTCCCCACCAACGATGATGCTAACGTGCGCATCTCTTGTACGTACTCGTACAGCTCGCGCTTCCCTTGCTTACAGG
CGAGGAAGCGTGAGCGCTGGCGGAACGTATCGTTCGCCGGGAGAAAAGCAGCGCGAAGCCGCTCGTACAACTGTTCCCAGTATGCAAAGCATCCAGGAGA
CGTCGTCTCCAGCGTGTACGCCCAATTCTTGGCACGACCGCTTAGGTTGGACAACGCGAACGCAACGCGAAGTCCCTGATCCGAGATGAGACCCGCCCTC
ATGTCGATCTCAACTTCTCGGATCCAGAAGTGAAGGTTTTCACCTTCCTTCCCTTCGAACGCAGGCACAGCCAGCCGCAAAGGCTTCGGCTGGACCGGCT
TCGGCTCGGCCACAGAGGCCTGCAGGTTCCCTGCACGTGAGCAATGAGCTCACGCTCATACGTGTCGAACGCGTGAACGCGTTCGACTTGCTCGGCTGGC
GTCACCGACGCCAAGCCTCGGAGGACATCCCTCCCAAAGATGCCTCCTATCTTTCGAACGGACTCGAACTGCGAGTCGTTCAAGTGAGGAAACTCACTTC
GTTCCATAGTGGCTCAGGCTTTGAGACCACAGAGGATTCAGGTAGTCCAATCCTACCCGCGTAGGCGTGGATTGACTACAAGTGCTACCAAGTG