Description :
From Genome Similarity Track
Location :
Scaffold_867:2274- 5664
Sequence
3390 bases(100 bases per row)
CAGGGAAGGCACGCAGTGTACAGTACTTGCCACCTCATTCAGAGCTTGCTGGGCTGCGTCGCGACGGCGTCATTGCTGCTGCTTCTCGGGTCACCACAGT
GCAGGTAGATGACGCGCACGAGCTCGTCGTACAATGCCTGGTGGGTCCGGAGCGACGGGAACTTGTGGCCTTCTTCGTGCTCGAGCACGATGCGCGGCGT
CGGGCTGTCGGCCGGGAACGGTTCGTACATGTTGACGAGGCGGTGGGACTCCTGGTAGAGGAAGTCGAGCTTGCCGATCACGTGCACCGACGGGATGGGC
ACCAGGATCTCCTCGCCCTCAGGCGTCTCGAAGAGCGAGCGGCACTCGATGGCGCCCACGCGAATGCCGCAGACGCAGATCGCGAGCTTCCACCAGCGCT
TCTTCTGGTTCGTGAAGTAAAGCATCGAGAGCACGGTGAGCAGCACGGAGCCCTGCGAGAAGCCGACAACGACGTCAAAGGGGCCGTACTTGCGGAGCTG
CTCGTCCATGAACTCGAGCGTCTCGTCGAGGCGGCCGAAGCGCATGTACCAGCGCGTGTTGGCCGCCACAGTCATGTTCAGGCGCGCCGACTTCTCGGAC
GAGTTCATGTCCACGAGCTCGCCGTCCATGCGCAGCAGGCGCCACCACTCGTAGAAGGGCGCGCTCTGCGCGTAGCGCTCCTCGATTATCGGGTCGGACT
CGCCCTCGGCCTCGAAGGGCGCGTTGAGGTAGACGAACTCGGCCGTGTCGCCCAGCACCTGGCGTAGTGCGCGCGTCTGGTCCTGCATCACCTGCACGTT
GGTGCGGGAGCCGTGGAGGCAGAGCACGCGCAGCTTCTTCGCGGCGGGCGTCATGGCGGGAGCTCTTATGACTTAGTGAGCAGCTCCATTACGCAATCTG
GTTGTGTGTGCAAGGCCAGCTTCAACCAGAAGGGATATCACGTCAACAATTTTGCTTCTGATTGGCGGAAATTGTGTGTTTGAGGTAGTTTTTAGCCAAT
GGGAGAGGAGGAGAGGGAAAGTGCCTAATCCCCGTTTGAGTGACGTGTTGCTCACGGAAGAGTGACATGATATGGGCGATCTTGAAGCAAGGATTTCAGG
TATGAATGTGGTCTATGTATGTGTGTGTGTGTACCTCGAGCGTGTATCTCTGCCCTCTGCTTCGCTTGCTATAGTCGTGCAACTGAGCTCTTGGTCGTGT
GCTCGAAGAACTGCAGGATCGCGGTCGCGAACTCCTGGTAGAACTCCTTGTGGCGGCTCGGCGTGGGGAACTTGTGGCCGCTCGCGGTCTCGAGGATGAG
CTTCTTCATGGGCGAACCCTTCGGGTGGTCCTCGTACATGTCTGCGAGCGCCTGGGACTCGTCGTAGAGCGCGTCGAGTTTGCCCAGGATGTGGATCGAC
GGGTACGACACGAGCACGGGCTCGCCCTCGTCGGTCTCGAAGAGCTCGCGCACGTTGATGCCGTGCACGCGCACGCCGCAGACGCAGATGCACATCTTCC
ACGGCCGCATATTCTGCCTCTTAAGGTAAAGCATCGAGAGCAGTGTAAGCATGATCGAGCCCTGCGAGAAGCCGAGCGCAATGTCGAACGGCCCATGCGT
CTGAATCTGCTCCATGATGTACTCGAAGGCCGCGTCAATGCCCTCGAAGACAAGCGTCCAAATGTTCTTCGTCTCGGCCGGGAACGGCTGCGCCGACAAG
TCCGCGATCTCCTCCTTCTCCAGGTACCGCACCTGCCACCATTCGTAGAAAACCGTGTCGGCGCCGTACCTCTTCTTGATCACCTCGTCCGTGTCGCCGC
GCGACGTGAAGGGCGCATTGACGAACACGAACTCGGCGGCGTCGCCCAGCGCGTCGCGGATGCCCTGCGTCTGCGTCTCCATCACCTGCACGTTGGTGCG
GAAGCCGTGGAGGCAGAGCACGCGCAGCTTCTTCGGTGGGAAGGACGTCATCGTGGCGCTGGTGCAATTGTGAGTAGTGAGCTGGGCGACGTGAAGTGTG
GACCTCCTCGTTGAGTGTCTTCTCGTACAGGCGAAGGAACGTTTGACGTCATCTGTCGACTTGACGTGTTCAAGAAAAAAATTAGATTCGCTCTCCATTT
TCATCCAATGAGAGATGCTCAAACTAGTATTTTTGACCAATCAGAACGAATGTGATGCGGAAACAACACGGAAACACACCACAATGCGGAAATGCACCAA
GGTCTATTAGTGGATGGATGCACTGCTCTGTGTGCATGTGCATGTTACATTTTCGACACCGGCGGGATGCCGCAGTGCTGCTCAATGACTCGTGCGAGGT
GGTCGTAGAAGCCCGGGTGGCGCGCCTCGCTCGGGAACCGGTGGCCGCCGTCGTGCTCGAGCACGAGCTTCGGCAGCGCGCTATCCTTCGGGTTCGCCTC
GTACATGGCCGCGAGCTTAATCGACTCCGTGTACAGCGGGTCCGTCTTGCCCATGATGTGGATCGACGGGAACGGCAGCAGGATGAGCTCGCCACTGGGC
TTCTCGAAAAGGTGCTGCAGCTCGACGCTACGCACGGGCGGCCCGCCCACGCACACGCACAGGTTCCACCAACGCACGTCGTGCTGCAGGTAGACCATCG
AGAGGATCGTGGCGATCGTGGCACCCTGTGAGAAGCCGAGCACGACGTCGAAGGGCCCGTGCTGTTCGAGCTGGTCGCCGAGAAACTCGAACGTGCGGTC
AAAGCCGACGCCCCGGAAGCGCCACTCCTTGTCCGTCGACGTGAGCGCCGTGGTCGCGTTGAGGTTCTCGGCACCGGCGTCGTCGTCGGCGCTCTTGACG
CGGCACCACTCGTAGAACGGCGCGTCATTGGCGTGTGCGCGCTCGATGCTCGCGTCCGTGGGGCCCTCGGCCTCGAACGGGCCGTCCAGGAAGAGGAACT
CGGCCTTGTCACCGAGCGCGTCGCGTAGCGGGCGCGTCTGGTGCTCCATCACCTTGGCGTTCGTGCGGAAGCCATGCAGACAGAGCACGCGGATCTTCTT
CTGGAGCTGTGTCGCCATGGCTCACTGGTTCTTCTGCTGGTAACGGCGCGAATTGATTAATGCCAGCGTGTGCCACTCCCAACATCTTCAGCTTGGCCAG
TCTTCACATCCCATGGACGACAGGATGCGGACGTGCACGGAGCGCCATTGGCCGAAAACAAACGTGTCGATTACGGTACTGACGGAATCGCGCCTCTTGG
GCTTTTGTATGATGACTTTTGGCGTTTGATGATGGAAAAAAGTCGTGTCCCTCGTTTAGGGATGAGGCTGGTGTTCATCAGGCCTGCGATGCGGTATGCG
GCCCTCAGCACAAGGTGTCCATACTGTAGCAGCAGCATAGAGTCCATGGGCGCTGCACCGGTCACAGAAGACGTACGAGGTCTCGTACTG