Description :
From Genome Similarity Track
Location :
Scaffold_305:2274- 3884
Transcript NameFunction/comments
Sapdi_VS20SDRG_17372hypothetical protein

Sequence
403 bases(100 bases per row)
CGTCGATATTCCATTTGAGCGTGCACACCGTCTCCAAGAGACTGCGCTTGATCGAGTCGATCCACTTTTTGTTGTGGACCTTGACCGGGACACCGGTCGC
CTTTGAGTGCTCACGCATGGCCTTGTCGTACTCGTCACGCTTCTCCTTCCACTTGATCAGGTACTTCCTTCCCAAGCTCTCGATGGGCGGGAAGTCGATC
GTCGAGACCATGAAGCCAGTCCGTGATGGGCCGTCGCCGTCCGTTGACCATCCGGCCAGCGCGCCCTTGGTCATTTTGCCGAACGCCGGTTCGAGACTAA
AGTATACTTTGTGATAGCGCCCGCGGTGCAGACACAAACAACAGCGAGGGGAGAGCCGTCTCCCGTGAAGCAGGCAGTTGTATTGGGCTTACACCACAGA
GGC