Description :
From Genome Similarity Track
Location :
Scaffold_70:227392- 242430
Transcript NameFunction/comments
Physo_120030hypothetical protein
Physo_139125hypothetical protein
Physo_157939ABC transporter related
Physo_139127hypothetical protein
Physo_139128hypothetical protein

Sequence
15038 bases(100 bases per row)
CATCCGGTACCATATGCGCGGCACTTGTCGTAGACGGTAGAGACTTTACTGCAACTTGCAGACACGACCCGAGCCATCATTCATATACTCTGGTTGCTCC
ATGTAAATGTCCGCTTCTCCTATGAGTTCATTCAGAAATGCAGTCACAAAGACAACTTGTCTGCACAGCACTCCGAGTTCCAGAGCCAGCAGAAGCAAGA
ACCGCACTGATTCAATCTTCGCGACAGGAGTGTAGGTTTCCCAAAAGTTAATCCCAAACTCTTGTTGGCAACCTTTCACCGTAAACCGCGCTTGATAGCG
CACTACTTCTCATTGTGCGTTCCTCTTCTTCACGAAGACCCACTTGTTCTTCAAGACTTTTACTCCTTCAGGTCGATCCACAAGTTCCCACACATGGCTA
CGCAGCATCTCTTGATGTTCCGTGTCCAGAGCTTTAATCCATTCCTTAGCATCAGGAGCAGGCAAAGCCTCTTCAACTGATGTAGGCTCTAGCAATTTAT
TCACTGCCTGAATCACTAAGCACGCTGGCATATCAACATCATAGTAGCTCAGTCGGACATTCGGTCGTCGAATGTGCGTCGACCGTCGGAACGAAGCACC
AAGTCCTTCGTTTGCCTCATCATCAGCCTCTCTCCCTGCTCCCACTGAGCGAGGAATATCTCCCATTGGATCACCGTTCGCAATTACAGCATCAACAGGA
TCATCATCTGATTCACTCCAGTCTGGGTCATTGTCCGCAACATCCGAGCCACTGAGAGCTAGCGAGTCACGTGAAGACGCAGAGCCACTGCAATTAGACA
GCCCTCCACCGTCCTCAAACGGTACAGAATAACTGCAGTTAGGCAGGTTCTCTTCACCTTTTGTACCGCTGTCTTCATCAGTATCCCTATGCTGCGGCAC
ATGATCCACTTCCCGTAGTCCACGCGCACGTGACGGCCGAGCTACAGTTTCACCTGCACCCGTCGGATTCGCGCTCGACGTGCTGCCTGCAGGAGCGCTA
TCCAGCGCCGGCCCACCCACAGCAAACGGAGCTTCAAAGTACAGTACTGGCTTACCCTCGTAAGTCCTCACTGCAACGCCGTTCGTCGCGATGCTCATCA
CTGTGATCGCTTTCAGGCTCTCCGAGAGGTCTTCGAGCTGGACTGGGGGACGTTAAATCGTCTAGCCGAACAAAAAGAATTCGAGACGGAAGCTGATACT
TGCCGCGCTTGAATCATTCGAGCAGAAGTTTTCCAACATAACTGTACCCCACAGTCCAGTTCTCAGCAAATTCAACCGGCCTAAGTTCCTTCATCTTTCC
AGTCTTCAAATCTAGAACGCGGTAGATTATTGACTCCTTGCCGTACGCGAGGAAGAGTCCAGGCTGTCCAGGATTATCTAATTTGTTCTTCCTTATGGCT
TTTGCAGTGAGGGTGCAGACCAAACAACCCCACGTCCTCAGGCTGGACAGGTCTGGCCGCTCTCCAAAACGTCGAGTGTACGGTGACTCTCCGCCAAGCG
CAGCACTTCGACTAATATTGAGTACCTCCTCCGCGAAACGAAACGCTTCTCCCCAGAGCAGGTTAGGTCGATTCACCGTAGTCAACAAGCTCCGCACACG
GGACAGCACGACCACATGCATGCGCTCAACGAGTCCATTTTCCTCCGGGTCTTTGCCAGCGTAATGCCATTCGCTCTCAAGAAGGCCTTGAACCGGTTAC
TGGTTAGTTCACCTCCTCAGTCCGAGCCACAAGCTTCAACTCGATGCTCTCGTGCGAGTATCCAAGCCACATGTTTCATCACAACATGGGGAGCTTCCTC
CTTTCGTTTCAGAAGAAGGCCCCACACGTAACGAGTCGCTTTATCCAGCACAAGCTGGAAATGTAAACAACCATTGTAGGTAGGCTCGTTAAGGAAGCAT
TCATCAGACATGAGCTTCTGATACGACACCCGCGCTCTATCAGTGGCCACCTGCAGCGGGGCTGCCGTAGCTTTGCGTCAGAGGGAGCTTAACAGACTCG
CAGAGTCTCAGCTTAAGATAGCCCGTTCTAATACCAGAACGTACGAGTCCGTACACCTTACGGACTCCAAGAGTCAACCCTTAACTCTTAACTGTGTGAA
TCTCAAACTGAATATATTTCCCTTTATTGCGGCAAAGCCGCCTACGGTGTAAATGTGTCCGGTTCACTATCTAGCATAGTGAACCCTAGTCATATACATA
ATCAGTGGCTCTGAAGCCATGTACTGATTCTCCTACTGATTTAGGTTAGACAGTGTGTACCCACCTCGTAACCCTTCGGGTAACTCATGTGTAACCCCGT
TACACCACCTGCTTGTACGACATCCGTTGCATCTTGGCTTGCACACACGTCCAACACTGCTATTCGGGCGCGCGCACACTCCCACTCAACTCCAAACCAC
CCACAGTGCCTTCTCGGACCATTCGCAGCAAAGCAGCAAAGTTGAGATGGCCGCGTCGGGCGTGCCACCGTACTAGAGCTCGCTCCTTGTCGGGTCTGCC
TTGCTCGATCGCCTCCACTTGCTTTGCACGAGATACCGTCGACTGCAAACGATAGCGTCCACGAGAATTCATCAGTCTCAGTAGCACTCTACCCTTGCGA
AGCCACGCACACTTCTGTTTCTTCAGCTTGACAAAGTCCCATCCGGCCTTCTCAAGCTTACCAGACACAATAACTTGTTTGTACCGCTAGCTGTGTAGAG
CACATTACCAAGACAGAACGAAACAGGAATATCAGACTGGTTCTCGTTCTTCACTCGAACATTTACTTTTCCAATCAACCCTCTGGTTTTGGACGGCTTG
CCTTCCCATTCAAACACCATAGGTCCATTATCTTGGCGTAGATCGGTCAGCATGTCCTTATTAGTACAGACGTGGAAGTCACTCGCTGAGTCCAAGATCC
ACTCGACTCCACCATCAAGAGAACTCTGCGTTGCCGTAGGCGCCGAACCATCATCACAATGAGAAAGCATATTCACATCACGCTTCTCGCCGTTTTTCCC
AGCTTTCTTCTTGTTTTGCCAGCGTTTCCGCTCTGGGAGTTGCGAATCAGACTCATCGTCATCGCGTTTGGGATTCGGACAATTTGTCTGGATGTGGCCG
ACTTGATGGCAATTCCAGCACTCACGCTTGTCCTCACCACCAGGCTTCTCTCCAACTTGCTCCTAATTTCCACTCTTAGCCGTGCATCTACCTCGACCAC
GCTTCTTGCCTTTTCATTACGGCTGCTGATCTTGCTGCTGACCTTGCTTCTTCCCAGCCAGCGCGTAAGAGATATCCAGACCTTGCTGTGGATCATCCAT
CCTGGCGTCGAGCTCCGAATCTGCTCCCAATGCGTTCATCACTTGAGCGGACGACGGAGTCGATCGCTGGTAACCAGAGTCAAAGTGTTTGGAGAATTGT
CGAACGACGTCGCGATGTGTCTGCGCAACATTACCAAGGAGAATCTCGGCGAATTCCTCGTCAGAAACCCCGCTTCGATAGTGCAGTAGCTCATTACGAT
AGAGCTGCCTCTCATGAAGCCAGTCATTCATGTTCCTCTCTGTCGTGTACGCGTTCGCAATCAACCGCTGTCGAGCGAAGATATAATTTGCATACTCGGG
TTTGGTCTGCTTATCCACAAAGGCAATCCACATATCTTGCGCGCTCTGCTGATGGCATATCAACTCAGCATCAGCCTTAGGAACGCCTCGCAAAACTGCT
CCACGAGCCAAATATTCAATCGACGAAATTGCCCCTCGCTTACAGCCGCACGAACCGCTGACGCGTTCTCCACGACACCCCATATGTCCATGTTGGTCAA
GAAAGTTTTCTGCTCTTCTGCTTACAAGTCAAAACTTCCTTGCATTACAGGTGGTTTATTCTCCATTTTCATTCCATACCAGCCAGTACAGACATCCCCG
CCTAACTCGACAGAGTGGTACCAATAAAGAATGCCAGATTGTATTGTGGTTTTCAGCGATTTTGGCAATCCGGAGCCCTCCGAACCCGAGATAGGGAGTC
CGGAATAGCGGACAGCTCCGATATAGCGAAGAGGATAGCCCCAAATTGATGTATGGGGTTAGGGCTGTACAACCAGCCAGCTCCGGTTTAGCCAGCACCC
TTACTTTTGCCGCTTTTCAGCGGCATAGGTGAGAGGCGTTTCTCGCTCATCCAGCCTCGTATTTGCCTCGCTTGACCCCGAGACTGCTGTAGGCTCACAA
CACTTTTGATGACGAGTTGCGGTCCATGCATGGTTCCGTCAAATATATAGCAATTTGGGCTGGTATTAGCACGTGTGTTCTAACGCGCCCCTAAACAAAG
ACGGTGTCAAATGCCATACACAGCGCCATTCACCAGCAAGCAAGCAACAATGGTCCCCTGGCGTTTAGCCTCTCCGTAGTACCTTACAGCTAAATATGCA
ACTGATCGCAAGACCATTATTTACTTTGTTTGTCGAGGATGTTGCGTAAGTATATTGTGAGGGTTACCCAGCAACTAAAACGACTGCAATGCATGCGTAC
TAAGTTGCACGAAGCACCTCATTTCATTACATGTCACTAACACGTCCTACAGTGAAGTGTCGATCGGCAGCAGCTATTCCCTGTACGACTCCGACTGGGT
TCATTACGAAGCGCCACGCAACAGCGATCAATAGAACTCAATGCTCACCTGCACGAGGTTTCTACCATGACCCGCGGGGTGCAAGCTCGAGTGTTTACCA
CGATGCTCCGAGTCCAGCCAGAATGACCTGGTCCTGCCCCCATCGAGTTCAAGCAGCTCGTGGGCAGCGACCTGCGCAGCCGAAAGGCTTAATCAACGGC
GTACCTTGCGCGTAAAATACCACCAGGACGTGCCCGTGGTGGCCTCGTCCAAGTACATCCAAACGGCAGCTGGGACACTGGCATGCCGGTGGTGGACAGC
ATCTTGGCCACGTCCGCGAAGGTTACTGACGCTTGTCGAACAGGTCAGCTTGCCATTCCTACGGCGCAGAGTGCAGCTCGTGCTCAGCTCCTCCAAGCAG
CGACGATCTGCCCGTGTGTAGTTGATCCCTGCAGGGTCTTGTCACGCCCCGTCAGACGAGCACTTGCACACACCCGACGCCATATCATGCTCACCTTCCT
TTGTCATGATCGTCTTACCGGTCTCGTCCGCCATCAGTTGCTGTACGGAGAAAGCGATGCCCAAAGCCATCGCTACTAAAAAGACGAGTTACCGCTGTGG
CTCACGTCAGCAGTATCGCGCACTGCTCCTACACAGCGCACCAAATAGACAGAAACGTCATAGATAAGCGATGCCAGCCTTACTGTCAGTACACACGTAC
CCTGAGCAAGTCCCCTCGACGAGAGGAGCGTACACCTACAGCGACGGCGAGCTGCATGCCACCTTTGATCATTTTGCTGGCTGGCATGCGTTGGTTGGTG
TGGGAGCTCCAATTTGGGCCTCCAATATAGAGTACCCTAACACATTAACGAGCTCGTTTGAGCAAAACAGGCCCCTCCAAGATGAGTACAGATTTCGCTC
CCACTTCCGGTGAGTGGGTTCAGCGGTAAGTTCTTAAAGGAAAATGCGGTATTAGTTTTAACAGACTAAAAATGAATCTGCGGTACGCGCAGGACCACCA
AGCGGACATCAGCTTCGTAGCTGCTGATGCTAACGTCGGAGTCAACACACTCGTCCTCTACGCCTCTAAAGACAATACCTGTGTGGGCAAAGCAGTTATG
GATCGTACGGGTGTCTTGTAGCTCGTTCCAGACCTCTCTGCTCCATTGCATAGCTTGCAACTGGTTAACCGCGTAAGCTTCCCCCGACTCTTTCGTCTGC
TTCTCTTCCTTGAGCTGCGGCTTATCAATGTCCTTCACCTTCTGGTAGGCCCAATGCATGTGCTTCCTCTTGTACCCCTGCTTGAAGGCCGCGATGATGC
CGGCATCCATCGGCTGGAGATAAGCTGTAGTGTTGGGGGGAAGAACTCGATCCGCACGTTAGTGCAAACGTAGTTTCCAGTACTATGGGACGAGGCGTTT
GTCCAGTAGTAGCATGATGTGACGTCCAGAAGCGCGCATCTCCCGGTCCCGATTCAGCAGCCACTCCTGGAAAATCGCACTTGTCCTCCACGCCTTTTTG
TTATTCTTGTAGAGAAAACCGAGCTCTTCCGCCGTGCGCTTCTCGAAGCAGCGTGGTTGCTTGGCTCGTCCCTAGTACAAGGGCGGGAACGCGTCGGATC
CGTCGGCGTTCGCTGTGAGCGCAATCGTTATCCTGATCTTACTTTTCTTAACACCGCGCTTGCCCTTGGTTCCGATGGAGCGCGCCGGTGCCATCGCATA
GCACAGTCCGGTCTCGTCCATATTATAGACGTCACAGGGGTCGTAGAGCTCCACGAGCTCTTGCAATCGTTGACGACCAGCTTCGACACTCTTCGGGTCC
GCTGAGGCGGCCTCATCATGTAGCTGGCGCAAGCGAAGTCCATGTCGCTTCTCGAACTTTGTTAGCCAGCCGTCCGATAAGCTCAGGTCCCATCCATCGC
AGAGCTCTACCGGCAGGTCTCTGGCTTTCATTCGGATGAATGCACGCGAGAGACAAACGCTTCTGGCCTCCGTAGCCTGGATCCAAAGGCGCTTCTCCAG
TCTGACAGACGTCACACGTAGCGGCTTGCGTCGATTTCCGTCACCGTAGCTCTCGCTCATGATGGCTTTCGCGTTCTTGAGGATGTCCGAGATCATCGAC
TGCGCTGGATGACGCTTGAGCGTGAACCGCTCCATTGACCACACTGCTAGCTCGGGCTGGGTCATCCAGGGATGCTCAGCGTAGTGCCGGACCAGCTCGC
GCTTCTGCGCTATCTTCATCCAAGCCCCCATTGCGCGCGCGTATCAGTGACTGTGTGTTTGTGTGACTGTGTGGTTGTGTGGTTTCCCTCTTTCGCGCCT
AAATTCAAGCGGAAACCGTGTCTCACTCACCTTACCTCTTTAAAATAATATTTTTTTTAAAGAATTCGCTGCATAGTTGACGGATGAACATGGAACCAAC
CATTTGTGACGCGTCACGTCGAGTTCCCTTCAAAGCTCATCTATCTCAGCATATTCATATGACAGCAGGAGCAACTCTCAGGCACAAACGTACAATCTGT
GTGAGGTACATTACTGATCCCAGAGCCGAATTCGGCGGGGACGTCTGTACAAGCGAAATGAGGAACCATCATAGGAGCGGCATGTGCACTAGCACCCGCC
AAAGACGATGCAAATGCAGGTGAACCCAGTGACGGCAGAGACGGGACTGATCCCCACGGCGAGGACGCAAAGCTCGATGCAATCGAAGCCGCAGGCACTA
CGGCTGCCACTCCAGCCCCAGAAAGTCGACCAGCTTCAGTCGCCCCAGCAAAACCACCTCCAGTTGTCCCCAAGAACGAAAAACCTCGTCAGCGTGCCTG
CAGTTCCACTCAGGCCAGCAGAGATCAACCTTGGGCCAGATGTAGTCGCACTCGCTCCAACACTCGATCCAGTAGCTGCAGGAGTCATCACAATCACCGG
AGGAGCGATTCCAATCGATCCAGCTACTGAGCCCACCGCAAAACCCGACGAAATAGCAATAGTTTGGCCGCCAGAAGCCACCATTGGCGTGCCGCCACCA
GACGACGATCCACTTGGTCCAGACATCTCTCCGAGCTACACGAGAACTGCTCGCAATGCCCTAGAGCCTTGGGCTCATAACCTGGCACGATGCGCAGGCG
AGTGTTGGTAGGAGAAAGAGCTTAGTAAGCAGGAAGGCGACCCTAAAAACGCACGTGCTTTCCACTGAACAACTTTGGGATTGAGGTGGGAAAAATTCGA
AGATGCCAACCCCCTCTGTGATAGCTGCAAACTACTATACGCCAATGGGCTCAATGAGACGCGTCCCGTATACGCCCAAGCAAAGGCAACCTTGGGCATC
CCAGGTGTATACTGTATAGTCCGTCACGCTGGAGCGGAGCCAGGGTCACTACCTTCTTCGCACTCCCACTTCGTGACACTGGCGATGAACATGGTAGGCT
TCGGGCTCGAGATCCTATGAGTATTGACAATTTCGTTTGCAATCAAACTAGAAACCGAAATGGAGATTATCACTACAGAAGTGCTTCTCAATGGAGAAGC
TGGCGTTCCGCTCATCGAGACTGTTGGGGGTGACGTCGACAGCGCCGACAATGACGACACAGAGGGTCTTACTCCAGATCTAACCACGAATGAGCAGGCG
ACAGCAGTTCGGAATTTTACTTGGATGCTGTCATAGCACCCCGACCTTGATAAATATGATAAATAGCTCCTACTGGATATCAGCGAGCCGCAGACACGGG
TGCTGGAGCAAATGCATCGCAGAGAAGGCCTCGCAGATTTCGATTAAAATCTTCTTTGTAGCTTGCTAGACGCTATCAGGTTGGTCAAATTCTTGTATCG
GTATCGGATTTCACATTTGGCACGTATCAGACTAATTGGCAGATTTACTCCAGATTTATTGTGAAAACCGATTAGTATGTCCAGCTGAATTGGCCAGTAA
AGCATCGCTCCGATACGATTTGGAGGCTGCTAAATCGGGGATGTCTCAATTATAATCGGAGTTTAAATCGTTCGTCGATCTCACAATTATGTGCAGCCTA
GCAATTCCGATCAACATACATCACCTCGGGCAAGTGCAGCGGTAACACCGCGCTTAAACCCTCCGCCTGCATATCTCAGTTACATGTATTATAGCGTGCG
GTTTTTCCTGCTTACTTAAGTATTATAGTTGTGCTGTTAGTATTGTAGCCTTGACTGGTAATACCTAGCCAAGAGCGACTGCAGCGATTGTTGTTTGCGC
GGCTGATTTAGCCTACAAGGAGCGAATGCCGGTTGCACATCGGACATTCCGTCTGAATAGCAAGCAGATCGGCCGGCTCTGGCTAAATGGGCTGGTTAGC
AAACCTAAATCCGATGCATATGGTTTGGCTCTGCAAGTCGTCCTTGCTAATAATCTTGAGGCTAATCGATGTGCCCCAGTCTAATTAGTAGGTCGGATTT
AGTAAATCGGCGATCATAAAATTTATGAGGGATACGGTTTCAAACGAAATGATGCTTAGGCGCCATTTGGAGTTTTCGAGATAATCGCGTTTGAAGTTGA
CCATTTTCGGAAATAACAGGACATCAAATTTTTGAAAGTGAAAAGTACATCTTAAAAGCGTCAAAACACTCTTATTCGATTGCTTTTAGCGCGAGCTTCC
CGATAATATAATGTGTTAAAATTGAAAAAATATTGAGGTCACACGCCCCAAATAAAATCGGGAATTAAGGGGGGTCCAAAAATTGAGATAACGTTTCTAG
ACCGATGTCACTCCACGAGTTCTTAACATTTTTGAGCGTTCGATAGCTTAAACGAAGTACAAGACACGCATCTTTCGATTGATGCGGTGTTAAATCGCGA
TTCGTACTTAGGTTCTTAAACATCTTTTCGTTTGAAACCGTCTCAAATCGTAATAAGCCACTAAATTGGCCGATTTACAATCCAATAAGACAGTCTTATC
GGTTTTCACAATACCCCATACCACATTTGCCTTTTTAACAGCCAAGTCGGTGGATTGACTCCGTATCATATATAGTAATATATCAGGTGTGTCAGGTATC
ATTTAAGACAGGATGGATGAGTGACCAACATTCGTCGCATGAGTACGTCATCTTGAATGAGCCAATCAGGTCGCTTCAAGCGCGAGCCATTTTGCAACGG
CCGGCGGTGTCTTCAGTTTCAATTCAACCGCTCAAGTCGCACAAGTCCCTGCGCAACAATGACGACACAGTCGTCCGCGAAGGAGGCCACGCCCCTGCTG
GGCAACGTGAGCGAGCACCTGGACGCCAAGGAGAAGAAGAAAGCGTACTCGCGCTGGCGGGACGACGATGCCGATGATGACGACGGCAGCAGCAGCGGCG
ACCCGCTGTCCCCCAAGCGCCGGCGCAAGTCCGCGCAGCGCCAGATGCTGTGTCTGCAGTTCAGTCTCCTGCTGCTGCTCGCCTGGGACCTGGCCAGCCT
CCTCCTGGTCTGCAGCTTCAGCCTCGGGGGCTCGGCCTTCACGCGGCTGCGCTGGCTGCTGGACGTGCATCAGACTCAGTGGCGCTTCTGGGGGCTGCCC
GTGTGGGCCACAGTGACCAAGAGCGTACTGTTCCTGCTGGCTACGCGCTGGCCCGACGCGCGCGTCGTCACGTGGGTCGTGAACCTCTTCTGCCTCGCGT
TCCTCAGTGTGTTGGCGGTGGACGCGTTTAAGCTGGACGCGATCTCCCGCCTCGACGAGGAGAAGCAGGCTCTGGTGGACGCCAACGTGGCCAACTCCCT
GCCGCTGATCTTTACGGTGCTCGAGGTGGTCAACTTGAGCTTCCTGCTTGACTCGATCAGGACCTCGCCGCCGGCGGAGAGTGAGACGCTGCCTCAAGTT
GCGGCGGACAAGCCCACGGAAGCGCCCAAGCCGCGCGGTATTTCCTTTGTGAAGCTCGTGTACATCTTGAAGCCGTACTTCTGGCCCCATGGGTTCGCCA
ACAAGCTGCGGGCTGCGAGTACGTACCTGGTGCTGATTCTGAGCAAGCTGGCGAATCTGGCGGCGCCGTTGTTCATGGCGTCGGCTACCAATTCGCTGGT
GGCGAAAGATATTGGTGGCGCTATCCGTGATATTGCCATCTTCAGCGGCCTCACGCTAATCTCCAAGCTGTTCAAGGAGATGCAGTCGCTCATTTACCTC
AAGGTGAAGCAGACGGCGTACATTGAGCTGGCGACGCTGACGTACGAGCACGTCCAGTCGCTGTCGTACGACTGGCACGTGCAGAAGAAGCTCGGCGACG
TGCTGCGCTCGATGGATCGTGGTGTGGAGTCGGCGAACAGCGTCGTGTCATACGTGTTCCTCTACCTGATTCCTACCTTGGCCGAGTCAGTGGTGGTGAT
TGTCATCTTTGCGATGCACTTTGAGCTCGCGGGGCTGAGTTTTGTCGCGTTCTCCAGTCTGGTAGTGTACGCTTACCTGACTATCAAGATCACGCTTTGG
CGCAAGAAGTACCGCGAGGCCTCGATGCGTCATGACAACGAGTACCATGACAAGGCTACGGACGCGCTGTTGAACTACGAGACCATCAAGTACTTCGGCA
ACGAGCGCCACGAGATTGACGAGTACTCCAAGGTGATCGAGAAGTACCAGCGATACTCTGTGTCCGTGCAGGCTTCGCTCAGCGTATTGAACGGCTCGCA
GTCGATTATTATCCAGGCTACCGTCTTGGCAGCGCTGGCTCTGGCAGCGCCCCATGTGGTCGATGAGAACAGCGGACGCAGAATCGACATTGGTGCTTTC
GTCGCCATCTCCGTGTACCTCACGAACCTCTTTGCACCGCTCTTTTTCCTTGGTGGTATCTACAACATGGTGATTAACTCGGTCGTCGACATGAAGAAGC
TGAGCGAACTGCTCTCGGTGGAGCCTGACATCGTCGATTCACCTGACGCGGTGCAGCTTGGTGTGTGCAAGTACGATTCCGAGAACGGCATTGATGTGGT
ATTCCGCCACGTGTCTTTCCATTATCCGTCGCAGCCAGCCACCACCGGCGTGAAAGACCTGAACTTTACCATCCCGCGTGGCACGACCACTGCGCTTGTG
GGCGAGACTGGCGCAGGCAAGACCACCATTTCGCGACTGCTCTTTCGCTTCTACGAATGCAACGCGGGTAAGATTTTGGTGAACCACCACAACATCGCCG
CAGTGACTCAGCAGTCGCTGCGCCAGGCCATCGGCATTGTGCCTCAAGATACGGTACTCTTCAACGACACCATTCTTCGAAACATCAAGTACGGCAACTT
AAACGCTACGTTCGACCAGGTCGTCGAAGCAGCTAAGGCTGCTCGCATCTACGACTTCATCATGAAGCTCCCTGACCAGTGGAACACAAAGGTTGGCGAG
CGTGGGCTCAAGTTGTCGGGTGGCGAGAAGCAGCGGGTTGCTATTGCACGCACTTTGCTGAAGGACCCACCTTTCGTCATTTTGGATGAAGCTACGTCGG
CGCTTGACACAGTGACGGAGCAGGAGATTCAGGCTGCTCTCAACCGTCTCAAGGCTAATCGCACGATGCTGGTCATCGCTCATCGTTTATCCACGGTAAC
TCGCTCGCAAACCGAATGGGAGATTTCTTACAGACAAGATGCTAACTCTCCTGCTAATGTGTATGTTCTCAACTTCAGATTCGCAACGCACACCAGATCA
TTGTCATGCAACACGGTGAGATTGCCGAACGTGGCACGCACGATGAACTGGTAGCGCAACCGAACAGTATCTATGCCGGAATGTGGGATGCTCAGCGCAA
GCACGAAGGTGAATCAACAACTAGCGACCGGGAGGAAGCTGCTGACGCCGAGTAGGGTTGAGGCTGTGGTGCAGGAATGCAGGGAACATTTACTTAACTT
TGACGTAAACACCGCCGATTTCCTATACACTTTCAGTGCAAGATATCGCCGTAAGTTGAAAAGTCCGAAGTGCAGCTTGAAGCCACCACCCCAAGCCTAT
GGCGGCCACGAAGTCCGCTGTTGTCAGCCGCGCTGGGTCATTTCCAATGTCCAGCGTGTCAGCCAGACCCGTGTGCGCGAAGTCGAGCGGTGGTTTGCTT
TGGTGTCGACGCAGAATGGCCCCGGCATCGACTACGGCAAGGGCAAGACTTGGGTGTCGCTGGCCACGATCGCTGCTGAGCTCAAGAAGTCCAACCCCAA
GAAATACCCCAACAAGAAGGTCGTGGTCGACGCCTTCTTCGGTGGCGAGTACCGCTTGCCCAGTTGGTGAAGCGCGTGCCGGACGACCAGTTCGCTGCTG
AACAGCTGAAGTCTTTGCCCGTCGAGCTCGAGACAGCCAGCAAGTTGCCCAGACGCGGTGCGCTCGTCCTGCTAGAGACCGCTGTTAATATCCGCTGCAG
TACCCTCCTCAAGACAACAGCAGACCAGGCGAGCCATTTGCTTGGATCTGCGACGGGGGTGGCGTGTACGTCATCGTCGTCTACGCGATGGTGCAATACA
ACGGAGAACCCCGCTACTACCTAATCGTGGAGTTTGGCAGCCCCGAAGACGATCTACAGGGCAAGGTGAAGACGGCCGCCAACAGGATGAAGCAGTAATG
TGGGCTGTTGTGCAGTCCAATTTGTGCTGCACACTGCACCGGGGCAGGCGGTGAACTGCGAAAGGGAATTCAAGCGAAAGATGTAGCATCTTCGGCTGCA
TTTTGCTACAAATTACGAGAACGACCAGCAGGAGATCGAGCTGCTGCGGCTTGCTCCCGTGCAGATACTTCTCGCGGGCCGCGACCAGCTCCAGCAACTC
GCTGGTGACTTCAGAACTGGCAGCTTTGTCAATGACACCGGAAGCAAGGCAGTTCATAGCCTCGTACGACTGTACAGGAGGCGAGGACTCCTCACCTCCT
GAGGAGGGCGTCACAGCTGGACTGATGGGCTTACCGTCGAACATTCTTCGCACCGCTTGCAGATAGCGACACATTCATGTTCATGGCTACGAATTTACAG
GCCAGGGGCAAAAACTCAAGTACGCCCAGGCATTGTGGAGGAGGTCCAGGCTTCGACGAAGCGTCGAGGTGAAGAGCTTGCCGCCCAGCCAGCGAAGAAG
CCAGCGGATGTCACGTTGATCGCGAATCTGGCCACGGAGACGCGCTAAGCCTTGGTGGCGGCGTGTCGGGTCAAAATTAAAATTTTGACTTTCACGTTCG
AGCAGCACCAGCACGCGGAGTACAACAAGCGCCTGAAGGCAGAAATTGAGGATCTTAAATCTCAACTCGCTCATCACGGCATCCGATTAGAGAAGCTCAA
CTCTCAGCGCGCTCAGGACGAAGAACGATTTCAAGGAGTTCTAGCTGAAATGGAGCAACTCAAAGCAAAAGTTGCCGCATTGTGCACGGGTCCTCATGTT
GCCTCCCAAGGGATCGACCTTACCAATCCGCTCTAGCCGCCACTACGAAGTTGCCGTTCAAGCATCTGGATTTGGGCTGTCTCGTTCATCCCGTGCAGTA
CAGGGCTTCAATGCTGCACCAGAACAGGTTTGCTACGAAGATCGAAATTTCTAGTTTAGCTTGCTAGTAGTGGGAAACGAAAGTGTTATTGAGTTTGTTG
CTCCGTGCAGTGCTCACTCGAGACAGACTTCTCGGAACTAAGTGACGGTGTCTCCCTTCTCCCTCCTATCTTGCAGCCGTTTACTCCACGTGCACTGGTT
CGCTCGTGTCCAGCTCATTGAACTGGAAGAGATCCGTCTTCTCCGTAAGCGGTTCCATGTAGGTGAAGAACTCAGCGTAGTACGGGTTCGCCTGGTGGAT
TTTGAGGCTCTGCTCGACCAACAACCACATCAACAACTCAGTCAGCATACTATATCGGCATTCAACAACAAAAAACAATACGCAACGTACACTTTCGCGC
TCGTAGCGCTCGATAATGGCCCACTTGCGTGTGTCGACGTGGTCCTGCATGACGTACCAGCCGACGACCTCGGCATCCTTCACGTACGTCTGCGAGGCCT
CGATGAGCTTGTTGCGGATTTTCTCTTCGACGTCCTTGCCTTCCTTAGCGCGGAATTGGACAACGAGCGTGTAGACCATCTTGGATGTGGCTTGAGTGGA
GTTTGGTGGCCAGTTGATAGCAAATTGCAGAATGACGTAGCTGAAGAGCAGAGCGGTGTGAGCTGCGATTGCTGCCATGTTGATTGCGTTCGTGTGATGA
GGTAGACAACCTAGATTGACGAAGTGTTGACCACTTCCTTCTTGACCTTGCCCAAGACAGTAATCCCCGGCTCAACTTTCGCACTTCAACTTGGTTAAAC
GAACAAAGAGCAAGACTGTGCCAATGTAAATAAGGCGTTGCGAATCATGACACCGTCGACGCCCTAGCTCTTCCGCAGCGAGCCTTTTGTATCCGATGAT
CTATTATACCTAATGGGAGCTTTATACGGTCAGGTCCTCGATGCCTGACGAGCTGCAGCGTTCAATGCGCGTGATGTCCCAGTCTCGGTCATCCGTCGGC
GAAAACGAGTTCACTGCTGCTAGCGTTTCGGGTGAAAA