Description :
From Genome Similarity Track
Location :
Scaffold_15:227386- 232082
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05217GI23404
Sappa_CBS223.65SPRG_05218Hypothetical protein
Sappa_CBS223.65SPRG_05219BSD domain-containing protein, partial

Sequence
4696 bases(100 bases per row)
CTCCAAGCACCCTTCTTTGCCCTGGACGATTCTTGGGCCACAAAATCACGCCAAGGAATGATGCACTTTCTCTCGAGTGTGAGGGCAAGCGACCCACTGG
CTGCGCGTTTAACCCAGTAGAGACCAGTTTAAACGCCATTGTTTTACCGGACACATAGTGGCTGTATCCGGATAGTGGCATGGTTGAGGCTTGATTTCGC
AGTGGCGGTGAGCTGATGACCAAGCGCCCGCTCGACGAGCTGGCTACCGAGGACTCGACGGTCGTCGAGTCAACGACGTACGCAGATAAGCCGCTACCGG
AGGGATGGCAGAAGGTTCTGCACCGATCCGGCCTCACCTGCTTCCTGCACGAAGCCTCTGGTGTCGTTACGTGGACCGAGCCGTACGTCGTCGAGCTGCA
CGACTCGGCCAGCATTAGCGCAGCCGCGGCGACACACGTGCCTCCACTCGAGATCTTTGCGTCCGGCTGCGGCATGCGCCATCCAGACCGCAATCGCCCG
GTGAAGATGGTCCAAGCCGACGGTACGACGGCGCCGAGCGTCCTACCTAGCCTTCATTATCCCGCGTAGCTATCATCCGGCGCCTCAGCAAGGCGGTACT
TGGCGACCGTGAGCCAACTCCGACTCCAACTCCGACTCCGACTCCGACCGAGCAGGTTCAGGTTCTCATGCGCCTTTGCGTCGCCGCCTCATGTGCCACC
GCGTAGCCGAGTTTGGACCCGCGCAAGAGGCTCAAGGCCGCCCACCAGAATGGTGCGTCGACGCCGTCGCCACCGCGCCGCCCGACAAAGCAAGACGCCA
AAGGCGGTCGGCCCAAGATCGTTCTCAACGGCGTCACCGTCGACGAGCCGACGGGGAAGACAGCGATGGCGTTCCTGCTCGTACGAAGACGACGACACGT
GATTCCGAGCGTGACATCACGTGTGTAGGACTATGCCAAGAACTGGGTGGATGCCATCCCAGAGTACGAGCAGACCAACTCGAATCGTACGTGGCCCGTC
TCGTAGCGCGGCCTGATTTGTTTGCAGACAGCGACGCGCCGTTCCGGTGCAGCGTGACGATCTCGGGGCAAGAGTACGGTCTTGCCGACGCGTCCTCCAA
GCAGCTTGCGCGACAGAAGGCAGCCGAAGCTGCGCTCGAGACGCTCGTGCCGGGCTACTGGCGTACGCTCAAAAGCGGCGGTGCGACACACGAAGTCGAC
ACGATGGCCGCAGAGCTCTCGGCGGCGCCCACCTTTGTACGCAGGCTTGCCAACGCATGACTCATACCTCGTGGTAGACGCTAAGCCGTTTTGAGAGCTT
ATTGATCGACGACCCGCTCGTGCTCCAAGGCTGCATGGACCTCAGCGTCAAGACGCCGGCGCAGCTTCTCTCCGAGTATGCGACGCGCAACAAGGGTATC
GCGATCAACTACACGCATTTCAACGTCCCGTTTGCGACGGACCGCAACAAGTTCAAGGTCGTCGCGTCCAATGGCAAGCACTCGGCCGAGGTAGCTCGCT
TGCGTCCTCTGCCGCGTCCGTGACGTCGTCTCGTTAGGCGGTCGCTCCGAACAAGAAGCTCGCCAAGCAGTACGCCGCTCAAGCGCTTCTCAAAGTGCTA
AATCCGAAAGTTGCGACCTACTATGAGATGGTCCAGCACCACGAGACGGTCGTGCTCAAGACGTCGTCGGCCCACAAGCCCAAGCCCGTCGTGCCGCTGA
CCTCTACAGGGCTTCTCGGAACGCCCACGACGCAACCGACGAGTAGCAACAGCATTCTTCCGAGCCCGAGCACCAATGGCCGGTTCCAACCGCGGCCGAA
TGCTCCGCCGCGTACCGATGCCTACCGTAGCAACGCGCCGTCGTCCTCGGTGCTATCCAGTCAGCACAACCATGTAAACAACCACATCAACCATCAGCGC
CCGCCTCCAGTGTCTGTCGCGTCTCGGTACGGCCAGCGCGACTATGGTGGCAAGTCCGAGACATCGCCGCACCAAGGTGGTCCGCCCGCTCCAAAGGTAC
GAGGATGCATCGACTGCGGGACGCCTCGTGATTCTCTTGCCGTAGCCGTACTCGTCGTATGCGCCACCGAGCGCGTCTGGCTACGGAGCATCGCCTTCGT
CGTCGTCATCGTACCGCGGGTACCATGGGGACCCCAAGGTCCATGAAAGCAACGGAGGGTACCAGGCCCCCAAGCCACGCGGCGGCTACGGCGAACTCAA
GCGGGAGCTCGTCGAGGACAAGAAGCGCGAACCGATCTTTGGCGACGCACCGCCGTGCTTCGCCGAGGCGCCCCGCGACGGGTATGGTCGCCCGGCGCCG
TTCGGGTATCGCCCGTCGGCACCCCCGGTGCAGTGGCAGCAGACGGCGTCGTACCAACCGCAGTCGTCTTACGCGCCGCCGTCGTATCCGCCGGCGTCCG
GGGGTCTCCTCCCGCCGCCGCCGACCCGCCTTGCGCAGCCTCCCAGCGCAAACTACGGGAAGACGAACAATCCGCTGCAGCAGCTCAAGTCGGAGCTGCG
AAAGTCGCTCCAGTACTAGTAGTTTTGAATGAATATAACCAAGTCCTCGTGTCTACTGCGGCTGCGGCGGCTCGGCGAGCAAGCTCCGGAGCTGCTCGAC
GTTGACGAGCATGGGCACAACCTGCCCGTTGATCAAAAAGTCCAGCGGACGATACACCGACACGCTGCTCGGTCGCACGGGCGCCGACGTCGGCCGCACG
TCGCTCGGCAAGAGCACCGGCACCATGGGCGCCTCGGCGAACGTCGCCTGCGCGTCGTACGTCGAGGTGGAAGGTACCTGGACGAGGCGCGCAGGCTCGG
CCTTTGGCATGCCCTCGAGACCATCGATGTCGCCGCCGTCTCTTCGCTTGAGGTAGACGAAGAGCTCGAGCTTGTATGCTGTTTGGCCGCCGCGACGAAC
CGACGCGTTGTTCCACGCGGACGTGATCGCCGCCATGTAGTTGCCGACCTCGATGCAGACGTACTCTTTCTGCGTCGCGTTCGTGCTCGTTTTCAGAAAC
ACCTTGACGACGCTCGGGATCTTGACGAGCTTGGCTTTACCCTGCGGCGGCGGGTTGGGGCTCTCGTTGTGCGTCACGACGGCGCGGTCCAGGTAGTTGG
CCGCCTTGGAGAAGAGCACGTTGAAGCCCTCCTCGAGGACGTGCTCAAACTCGTACGTCGCAACGGTTTTGCGGCTCTTGTCGCGCTGCCCGGCCTTGAC
GGTGAGGAGCACGGGGAGGCTCGGCGGCAGCGGTGCCATGATCCCCTTCGGCGGACCCATCAATTAATATTTCGTTGCCGCTTTAGGGCGACGTCACCTG
GCTATTCGCACGCAAGTCAATATGTATCTTTGTATGTAGGACAGAGTCACCGTGGCACGCATGGTCCCAAGTCTTCTCTACGCCCTCACCGAGCATACAC
ATTGGCTCACCATTTGTTCGAATGGCGAAAAGTTGCTCGTTGCATTCGTATGCCTTGTCTGCTCGCCTAAAAGCGCACCCTTAGAACCTGCCTCAGAACT
GTGTGGGTTATGGTTGCGTGCAATTAGCTAGACAAAGACGGTTGCGGCATCGGAAAGTATTCTCTTTCACTTTTGGCGAGAAGCGACGCAAGCATGGCAT
CGTACAGCTTCTACTCGCTCGTCTCTGCGGTCAAGGACAAGGTAGACGCTACACGCTAGCAGGTCGAGGCTAACGCATCAACGACGTAGTCGGCCAAGGC
CATCTCGACCTTGAGCTCGGACCTCCAGGAGTTTTCAACAACCGTCCAAGGCGTACGTACAGGCCGCAACCGCTCTGGCCTATATCTACTGCGCCTAGGA
CGTCGCTGAGGTGGCCAAGCATGTCAAGAAGAAGGTTGAGGAAACGATGGAGTCGAAGCCTGCCGCTGAAGCGACGGACGAGGCGGCTCCAGCGGACAGC
AGCAAAGCACGCGAGCTCCAAGCTTCGGTGACCGCGTCGCTCTTTGCGTTTGGGGCCACGCTCGAGTCCGTTGGCTCCAAGCTTCTTACAAGGTAGAACA
ACGCCTGCAGCGCATGCGTCACCTGTCTCTGTAGTGCGGATGAGTTTATCGGCGGCTTTGCCGGCGACGAAGCTAACGACACACATGACGAGCCACTCGA
CGAAGCCGCGAGGTAGGCGACCGCTCGATCGTCCTTTCATGGTAGCGCTGCGGCTCTAGTGCTCGCCGCTTCCGTCTCTCGGCGATGCAGAACGCCGACG
AAACGTACGTCGAGCCGCCGGCCAACATGGACGCCTACACGGTCCGCATTGCAGTGCCGCCTTTGCCTGATGTGCTCTGTAGAAGTGGCGACAGGCCATT
TCGGACGACGACTGGGCGGCGCTGTGCGCTGAAGTCATTGAGCACTACCCCACGATCGACACCAAGCGCCAAGAACTCGGTAGACTCATCGAAGGACCAC
CGACGTCTGACAGAACATGTCTAGTGCCGGAATTAGTCTCAGAGGACGCGTTCTGGGGCCACTATCTCTACAAGGCGTCGCGTCTCGCAGCCCAGGAACA
GCGCAGCGCGCAGTTGCTGCAAAAGGGTTCGTGCTCGGATCGGACGAAAACTCCAATGCTGATGCAGCATATCGTAGTGGCGGGCGCGAGCGCGGACGAA
GAAGAGATTGGTTGGGACGTCGACTCGCCGCTTGCGAGCCCCACGGCGAAGACAGAGCGTACGGTCATGGCGCCAACCGATAGTATGTCATGATTC