Description :
From Genome Similarity Track
Location :
Scaffold_24:227369- 232207
Sequence
4838 bases(100 bases per row)
GAGGGAAACGGAGAGAATCTCCTCCCTGTGGATAAGAGAGGGGGAAATGGACATGAACTCCGCTATGCTTCAGTCGGAGCAACAGCGAGTTGGGATGGCT
CTCTCAAAACTGAGTGGTAGAGCCAGAGAATAGGCTATCACGTGTAGCACGTCGGTAGACGATGCTTTCCCCACATGGAATTTGCTAAAACAGCAAATAT
TCCAGGTGTTTGCTCCGCCTAATCAGGCATACCGGGTGCGTTCTCGTTTTCTATCTGCCTGTTTATGCCAAGAAAGAATTATCGGAACATGTCCAGGAAC
TGAGAACTCTAATCGCTGCCATGCAGCCTTGATCCCTTACCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGCCTTCGTACGGGCGTGACTCGAACGG
AAGTATTACGGGTACACTCCACCTCCTTTGATGCGGCTGTGGATACCGCGTTGAACCGCTGAGTTCAACTTTAAAGCAGCCCGTTTTGGCACCCATGGGT
ACAACCCAAACTTTGCTAACTCCTTTAGTTCATTCAATAGGCTGGAGTCTATGGACCTCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAGCTGT
AGAACAGCATCAAAACATTCGACGATGTTTCACGTGCGGAAGCACAAAGCATCTGCGACCTAATTGCCCTTTACGCAGAACTCGCCATGCTACTTTAGGC
CGAACCCCCGCCGCTAACCAGAAGTCTGGTACGGTGCGGGAAAACGTAGACTCCCAGTAGGCGCGGGGCTCCCTGATAGGGAAGACTAGATTCTGTTGGG
CCTCTAGGAGGTAGTGGCGAGCAGAATTTAGCCCCAAGGAGTCCCGTGCACTCTAAAAAGGGACGTGAATACAAGCCAGGCTTGTTGATCGCAAAGGCGA
CTGTTAAGGGCTTCGACAAACCCTGGTCGATTTTGATTGACTCCGGAGCATCCGGTAATTATGTCGGACGCTGTTCCCTTGAAGGGCATCCACGTTATGT
TGAGGCGCTAAACGCGCACAAGGGTGATACGATCACTGTTCGCTTGACGACAGGAACTCTATTCACTGCACTCAAAGTTCCTGTGAACTTGGGTGTGAAG
TTTTTCGATTTTGATTGTATCGAACGCTGTTTAGTCCTTGATTTGGACTCAAGATATAATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATGAGCCAT
GGATAGACTGGAGGTCGAAAACATTAGGCGCCACGCGCACTGCCCCTATCGGAGCTTTGAAGAGCCATGAACTCACCCTACTATAAATCAGAAGCGTTAT
TGGCGCGAGCCACTGGCTGACAATGTCAGTGTGCTGGACATCGGAGTGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGTGTATAGAGCAAAGCT
CGATATGTGATAGTGAAGCGGCACGTACTCTGCTAAGTGATAGTCGTTGCAAGATCAACGTACTGAATGCTGAAAGCATTGCTGACCAAGCATCAAGTTA
TCGAGGGTTGAACCCATCAGATGAGCGTGTAGTGGCACGTAAGTACCTGCGTGACGTTGGCTGTGATAGCGACGCGCTGAATGTTAATATTGACGTTGTT
GGTGAAATACCAAGGCATTCCAAGCCCGGCTCAGCGGATGCACGTGAAGTGGCACGTAGTCCACGTGATGACGAAGTCATGTCGAATGACTTGTCATCAG
ATGTCGGTAGTGACATCAGCTCTGGCGCCGAGTAAATTACGTTCGATGATGGCATCGTTCAAAAAGAAACGAATCACATAGCGTGTTCTGTGTCACAAAG
TGATGATGACTGTAAGCTGTATAAAGTCGTCAACGGAGTGACTGGTGCCTGTGATGGTACAATTACCCTTGAGGCTATAACCTCGAAACGTTCGCTTTTA
GAACTCGAAGAGTTGTCGGTCGATGAGTTTGATCACTCACTAAAGAATGGAGACCTTTCAGAGGTAGTGGTCATTCGACCCGACATCATAGAGTTAAAGC
CTTCTTCACTTTTGGATGAAGCCGTTCTGGAGGACACAAAAGTGGCACTCAGTGCACGTAGTGGGTAATTGAAAGACCCTCATCATCCCTTTTATTGCTT
AGTCAAGGAATTTCAAGATGTGATGTGCCACGATACACCTTCTGTTCTATCTCCAGATAGAGGTGTTCGTCATGAAATTGATTTAGCTCCTGGAACTAAA
TATCGTGTCACACGACAGTGGCCCTTTCCTAAGAAACAGTGTGATGTCATTGATGACTTCTTCCGTGCTAAGCACGAGGCAGGAATGGTACGTGAGGGTT
AAATCTTCACATTCGACACCGACATTTTGTGTCAAAAAGCCGCACGGCAAGTGGCGTATTGTGCATGCTTATAACAAGCTTAATGTGGTTACTATTCCGG
CACAGACACCCATTCCTTGAATAGATGTTCTTCAAAACAACATGGTTGGTTGCACTATGTATAGAGCACTCGACTTGGTCGATGGATATTATCCATTTCT
CATGCGAGCGAGTGATATTTCGCTGACAGCAGTGAGCACCCCGAGTGGTATGCTATGGGAATGGCTGGTGATGCCTCAAGGGCTGTATAGTGCTCCAGCA
ACATTCAATCGTCTGATGACGCAACTTTTCTGCCCACATCGGGATTATGCACAGACGTACTTTGATAAATTTTTTGTCCATAGTCGTGCCGAACAAGGTC
GGTCAGATGTTGAAAATCACATCGGTCATTTGCGAGCCATTATCGAGTGCATGCGCACTAATAAATTGTACGCCAACGCGTCTAAATGCATTTTTGATGC
AGAGGGGATTTTTTCTAGGATGTTTCATTGGTAAGCGCGGCCTTAGAGAGGAACTCGCTAAGTTCAAGGCTATAGTAGACTGGCCGATTCCTAAGAATCA
AAAAGAATTGAATAAGTGGCTTGGTCTTGTCAATTACTTACACAAATACAGTAAAAATTACGCTGACATGGCTCGGCCATTAACTGATCTCCTTAAGAAG
GACACAGATTGGCGCTGGGACAACACCCATGGTGACGCATTTCGGACAATAAAGAGAGTCTCCTCCATGCTCTCATTTTGGCGTTGCCAAATCCTGAGTA
CCCTTTTGGTGTTGTCTGCGATGCATCCGACTTTGCTATAGGCAGCACCCCGTTACAACCAGATGCAGGCCGCGAGCGAGTTACCGCATTTGAATCTCGT
CAGCTGAAAGCTGCTGAAAAGAATTATCTATTTCATGACAAAGAGCTACTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGTATCCA
AGCCATTCGTCGTCTACACGGATCATGCGTCATTACGCACAGCGACACAGTCGCCTCATCTTTTTCAGAGAATGTCTCGGTGGATTTCCTTCTTTGCGGA
ATATAACTTCGAGGTGAAGTATATTCCATGCAAACACAATGGGTTGGCAGATGCCCTCTCTCGCCGACCTGATTATGAGCTTTCTCATGTCACGACTTTG
TCGTCTCCTATTGAGGAGCTCATTCGTGTGGCATATCCACGGGATTCTCAGTGTGTGGCATTGTTTCATGCCCTTGGGAGTGAGGAATGCAAGGACTCGG
ACAGTCAATTATCGGCACGCTTGCAGGCCAGCCTACATCGATATTCCATCGATAATGGTCTCTTGTACTATCGCACAGATGTAGCGGATACCGCTCGCAT
TGTTGCACCTCACGATGAGGATTTAAATTATCGAATCCTCTTTGAGGCCCACGATACTGCCCTCAGTGGGCATTTGGGCCGGGAATAGACTTATGGCTCT
GTGAGTCAACACTACTGGTGGCCCAAACTCTACAAATGAGTGAGCATATACGTGCGTACATGCGAAACATGCCAGCGGGTCAAACCCTCAGCACATTCGG
CTGCACCACTCGCCAGTTTACCTGTGCCCACGGGGTGTTGGGAGTCCATCAGTATGGATTTTGTGTTTGGTCTTCCCGAAGACTGTGACGTCAATACGGA
AATTGTGGTTTTTGTTGACCGTTTAAGCCAGATGGCTCACTTGGCGGAGGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATGCTGTTTATCTATCGT
GTGTTTTGTCAACACGGGTTGTCGCTGGCAATCATCTCTTATCGCGACCCTCGCTTCACAGGCAATTTTTGGACTTCCATCTTCGAGGTGCTTGGCACGC
GATTGGACATGTCCACAGCGGATCACCCGCAGACCGATGGTCAGACTGAGCAAGTTGATGGCGTATTTGGCGACATTCTTCGCAGTGTTTGCGATGAGGC
GCCTAAGTCTCGGAGCTCGATGCTTCCTGTCATTGAGTTTGCATTAAACAACGCTGTATATGCTTCGACCGGCTGTACTCCCTTCTATGCGAATATCCTC
ACGCACCCCCGCGTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTTGGTGGGGGAGAGTCTGCTGACAAGATTGCTGATATCAGACCTACCACTATGC
AGAAACAAGTGAGCGAGTTTCTAACGACGCGCTGTAGCGTCTTAAGACATGTGCGTGATGCAATGGCTGATAACCAGAACAAACAAAAGAGCAAGCTGAT
GCTAAGGGCAGAAGATGTATTGATTCTTATAAAATGGGAGACCAAGTTTTATTAAAAGCTAAAAACCTACCTACAATGTGTAGCGTCTGCCGTCTTCAAG
ACGAAATTACGTCCTCACTTCATTGGGACGTTTAAGGTCATAGCGAAGAATGGCCTTGCCTATACACTCAATATCCCGCGCAATCTGCGCACACACCCAG
TGTTTTACGCTGGCTTGCTTAAGTCATATCATGATCCT