Description :
From Genome Similarity Track
Location :
Scaffold_606:22733- 23923
Sequence
1190 bases(100 bases per row)
TCCGGGGTATTCGGCCTGAAACCCCCAATCTGGATGTATTCGATCATTTCTTCTactgtcgaagctgctgtgtcGGACATGACGCCCAGGTTTCGTTCGA
TATCTTCTGAAAACAAGCCTCCGCCTTTATGATAACAGACCTGCTCCACCTTAGCTTCTTCCGACTCGGCTCCAATGAAAGATCGCAGATCCTGTCTGGA
TTTGGTCGACTTCTCTTTCTGGATCAACACCGGTTCCTGGGCGACTTGTTTTCGTCCGCTCCCTCATGCTTCATCTCGATCTTCGGTGGACCTTCCTTTG
TCCCTTCATGGGGTGAAGGTAAGACTGTCGCTAAGGTTATTATGGGCTTAGACAGCTCACCTGGTCGACTCAAAATTCACGTCGGTGTCGATATTGAGGC
CAATCCACCAGCGACACTACTCGGCTCCTCTTCGGGCTCTGCTTCCTCGCGCCGCTCAGTGGTAgcctcgagcgcgaggtTCTGCCATTCAGCATATCTG
CGTGAGTCAATCGACAAAAGACTGACATAGGAGGTATGACATCTGGGGCTAACCAGATTCAGTCGGGGTAGGATGCAATACGTGGCATGGACTTCATGGT
ATCAGTCGGAGTCCGTCTCGATGTGGCTGATGGAGCTTTCATTTCCCCGGCGAGGTACATATTCATCTCCTAGAACGACGTCCACTCTACGGCGCTACTA
TCCAGTCCGTCACGATTGACCAATATCCTGAAGTTTCAGTCACCGAGGCCATAGAGGTCCGGATTCGGCACAGCAGATCGGCCAGCGCGAAGCTCTGGAT
CACACGGGGTCCAAGATGGGTGCCGACTGTCAAAGGCCTGGGCAGGACGAGATACCTGCGGATCAGAAACGTGAGCGAAGAGAAGTTAGTGCTAGATCGA
CAACAAAATTTAGGATCACCGATATGAGTGCCGAAGTAGTACACCAACGATCATCCAGATAGTGTGACCTTGATCGTGGTGTCAGGTATGTTTTCTCTCC
GATCCCGACATCTTCTTGTCTATGAATTTTGTCTATGACACGTCCAACCTTACGAGCAAAGGTGGCGCCAATGATTGAAATTTCAGCGCCGGGTGTCGAA
GAGCAACGTGGCCTTCTCATTGTTCATCTTGGCGACGGCTTTGGTGTACTTGAACTACTTCCCAGGAGCATGGTACTTCCAGTACCCTCG