Description :
From Genome Similarity Track
Location :
Scaffold_606:22732- 23923
Sequence
1191 bases(100 bases per row)
TTCCGGGGTATTCGGCCTGAAACCCCCAATCTGGATGTATTCGATCATTTCTTCTactgtcgaagctgctgtgtcGGACATGACGCCCAGGTTTCGTTCG
ATATCTTCTGAAAACAAGCCTCCGCCTTTATGATAACAGACCTGCTCCACCTTAGCTTCTTCCGACTCGGCTCCAATGAAAGATCGCAGATCCTGTCTGG
ATTTGGTCGACTTCTCTTTCTGGATCAACACCGGTTCCTGGGCGACTTGTTTTCGTCCGCTCCCTCATGCTTCATCTCGATCTTCGGTGGACCTTCCTTT
GTCCCTTCATGGGGTGAAGGTAAGACTGTCGCTAAGGTTATTATGGGCTTAGACAGCTCACCTGGTCGACTCAAAATTCACGTCGGTGTCGATATTGAGG
CCAATCCACCAGCGACACTACTCGGCTCCTCTTCGGGCTCTGCTTCCTCGCGCCGCTCAGTGGTAgcctcgagcgcgaggtTCTGCCATTCAGCATATCT
GCGTGAGTCAATCGACAAAAGACTGACATAGGAGGTATGACATCTGGGGCTAACCAGATTCAGTCGGGGTAGGATGCAATACGTGGCATGGACTTCATGG
TATCAGTCGGAGTCCGTCTCGATGTGGCTGATGGAGCTTTCATTTCCCCGGCGAGGTACATATTCATCTCCTAGAACGACGTCCACTCTACGGCGCTACT
ATCCAGTCCGTCACGATTGACCAATATCCTGAAGTTTCAGTCACCGAGGCCATAGAGGTCCGGATTCGGCACAGCAGATCGGCCAGCGCGAAGCTCTGGA
TCACACGGGGTCCAAGATGGGTGCCGACTGTCAAAGGCCTGGGCAGGACGAGATACCTGCGGATCAGAAACGTGAGCGAAGAGAAGTTAGTGCTAGATCG
ACAACAAAATTTAGGATCACCGATATGAGTGCCGAAGTAGTACACCAACGATCATCCAGATAGTGTGACCTTGATCGTGGTGTCAGGTATGTTTTCTCTC
CGATCCCGACATCTTCTTGTCTATGAATTTTGTCTATGACACGTCCAACCTTACGAGCAAAGGTGGCGCCAATGATTGAAATTTCAGCGCCGGGTGTCGA
AGAGCAACGTGGCCTTCTCATTGTTCATCTTGGCGACGGCTTTGGTGTACTTGAACTACTTCCCAGGAGCATGGTACTTCCAGTACCCTCG