Description :
From Genome Similarity Track
Location :
Scaffold_162:2273- 3560
Transcript NameFunction/comments
g17593.t1hypothetical protein

Sequence
1287 bases(100 bases per row)
CGAGCTGCGGCAGCTCACGCAAGAGAAGACGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTG
CGGCAGCTCACGCAAGAGAAGACGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCACTACGCAAAGCGTTCGAGCTGCGGCAGC
TCACGCAAGAGAAGACGCTAGAGCTGGGGCTCGCGCAACCGAGAGTGGTCGAGCGGGGTCTCCCGCTACGCAAAGCGTTCGAGCTGCGGCAGCTCACGCA
AGAGAAGACGCTAGAGCTGGCACAACTACAGCGGGACTACGTCCAGGCGGAGTACGCCGCATTGCAGACCCCTCGGAGAGGGTGGCCGGACCAACGGTAT
TGGACATGCTCACGGGCGAATGCAAGGACGGCGGGAAGTTAGCTGTTCTGCCCGCGGTAGCAGAGCTACTGGAACTCGAAGAGCTCTCGTATGTCGAGTT
TCTCGACTCTCTGAAGGCGGGCGTGCTCGAGGAGATGGTCCTGATCCGACGCGAATTCGATTCGATCGAGCTCAACACCTCCTCGGTCATGGACCCCGAG
GTGTTGGAAGACGAGAGGACCTCCTCGCGGCAGAAACGATATGGCGCGGCCATTTTGAAAGACCCGTCGGATCCGTACTACCCCCTTTTGAAGGAGTTCT
CGGATGTGGTCAGCGATAACCCACCGTCGGTGTTACCTCCAGATCGAGGTGTGCGACACGAGATCGATTTGGTGCCGGGCACCAAATATTGCACCACGCG
CCAATGGCCACTACCGAAGGAGCAAGTCGATGTGATCGACGCATTCTTCGCGGCGAAATATGCCGCGGGCATGGTGCGCGAGTCAAAGTCGCCGCACTCG
TCTCCGACGTTTTGCGTGCGTAAACCCAATGGGAAGTGGCGTATGGTACATGCGTTCAACAAGTTGAATGCAGCAACCATCCCGGCGTCCACGCCAATCC
CTCGCAAGGACGTGTTACAGAACAACATGGCGGGCTGCACCATCTTCAGTGCACTCGACATGGTCGATGGCTACTATCAGCTGCTGATGCGGGAATCAGA
CGTCCCGCTCACAGCGGTGAGCACACCCAGCGGGATGCTGTGGGAATGGCTCGTGATGCCCCAGGGGCTGTCGAACGCACCAGCCACGTTCAATCGATTG
GTGACTCAACTCTTCCGGCCGATGCGGCAGTTCGTACAGACGTACTTTGATGATATCTTCGTGCACAGTCGTGCCTCAGGAGACAAG