Description :
From Genome Similarity Track
Location :
contig_2:227104- 228938
Transcript NameFunction/comments
g541.t1XP_009523044.1 hypothetical protein PHYSODRAFT_492233 [Phytophthora sojae

Sequence
1834 bases(100 bases per row)
CGCAGGAGAGGCTAGTGAAGAGGAAGTGCGGGTACTCATGTGGTTCCGACGAGACCTGCGTGTGCATGACAACTTGGCGCTCGCTGCGGCGCTGCAGCTG
GTGAGAGAACAGGAGGAGAAGATGACGCAGTCGTTGGGACACAAGGTGGTGTTCATCCCGCTGTACATCGTGCACCGCCCCAAGATCATGCTCTGCGGCG
TCAACCGCTTCCAGTTCATGCTCGAGAGCGTGTCGGACTTGGCTGACGCGTTGGCGGCGCGAGGCTCGCGGCTCGTGGTGGCCAGAGGAGACGGAGTCCA
AGTGCTGCGGCGCTTGCTGCCGGCGTGGCGTATCACGCACTTGTTCTTCGACGCGGCCAGTGAACCGTTCGCTATTGAGCGAGACAACCGTGCAGTGGCG
TTGGCCAGCAGATTGGGGGTTCAGACGCACGTGACTCATGGATATACACTGTACGACTTGGACGCAGTGATCGCTACGAATGAAGGAGAACCGCCAAAAA
CCTACACAGCGTTTCTGCGCGCGTTGGCCATGCAGCCGAAGCCACCCAAGCCACTCCCTACGCCGGAGAAGCTGCCGACCCCCACGTGGATGCCCAGCGA
GTTATATCAACAAGTTGTGGACTACTGGAAAGTCCGATTGAAACCTGAGAGGGTGGTGAAGCAGCCTGATGTGAAGGATGAGAAAAAGGAGGAGGAAGAG
GAAGACCAGGAAGAAGCAGATGACGACCCGGAAGAGAAGGCCAAGCAGCTTGACGAAATCGCAGGCCCAGAGCAGCAGTTTACGCTTCCGGAAGTGAATG
ACTTTGGCTATGACGCTCCTGAGCGACACCCTTTTATCTACGGCGGGGAGCAAATTGCGCTGAGCATTTTGCGTGATTACTGCCGCAATGAAGGCCGCGT
GGTCAAGTTCGAAAAGCCCAAGACGTCTCCAGCTCAGACAGCCCCATCCGCCTCGACAACCTCGTTGAGTCCGTTCTTGTATTTCGGTTGTATCAGCCCA
CGAACGTTCCTGCATCACGTGCGAGCTATTCAGGAGCACCACGCAACAGCATTGTCAGCTACACCCGTAAGCTTGGACGGACAGATTCTCTGGCGTGAAT
TTTTCCACTGTCATGGCCGGGCTAATCCGTACTTTGACAAGATGGAGGAAAGTCCTACGTGCCTGCAGATCGACTGGCGGTGGCACACGATTCCGGAAAA
GGAGGAGGAGCTGACCGACGACGACAAGCTTGCTCGCTCGCAGTTTGATGCTTGGAAAGACGGCCAGACTGGTTTCCCGTGGATCGACGCCATCATGATC
CAGCTGAAGGAGGAAGGCTGGATGCATCACTTGGCGCGTCATTCGGTAGCATGCTTCCTTACTCGCGGAGATTTGTATATCTCATGGGTGCGTGGGCTCG
AGGTCTTCCAGGAGCAGCTTATCGATCACGACTGGAGCATCAACGCCGGTAATTGGCTCTGGCTCAGCAGTAGCTATTTTTTCTCGGCCTACTTCCGCGT
GTACTCTCCGTCTACCTTCGGCAAGAAGTGGGACCCCGAAGGCCTCTTCATTCGCAAGTATGTGCCAGCATTAAGTAAAATGCCGGTCAAGTACATCTAT
GAGCCGTGGAAGGCGCCAATGACCGTACAACATGCGGCGGGCTGCCTCATCGGCAAAGACTATCCGTTCCCGATCGTAGACCATAAGATCGCTATGCGTC
GGTGCATGGTCGGCATGAAGAAGTCCTATGCGATCAATCAGTATGGAACACCACCGGTCCCTAAGCCACCTGTGAGCCCCCGCAGCAAGCGTCAGCGTGA
GCACTCGGCGAGCTCGTCGGAGACGTCAGAAGAC