Description :
From Genome Similarity Track
Location :
Scaffold_261:2271- 3630
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_261-snap-gene-0.11UPF0183 family protein
Pytir_DAOMBR486maker-pir_contig_261-fgenesh-gene-0.7H/ACA ribonucleoprotein complex non-core subunit NAF1

Sequence
1359 bases(100 bases per row)
GATTCGCACAATGTTTGGTGGTACGTCGGAACTCCGTCCAGTAATCCATGACAACGGACTGGGGTTGCACCCATTCGGCTCGAGTTTGTGCTACAGCCCC
ACGCCTGGATGCATCTTTGAGGTTCGTGATTGTGGTCGCAAGCAAGATCACTGAATGCTGAGAATCGGAGCCATTTGCTCATGCTTTCTCTCTTTCTTTT
GAATTGTTCAGGTGATGAAGAATGGCTACATCGCCAGTGTGACGCTCACGTCAGTCTGAGCACACATACTCGATAAGAATAAGAAGCGCTTTTCATCGTA
GAACCAAGTCACAAGAGTCTATCAAATCCGCAACGAGCACCAAGAACGAAAGATGACACACTAGCTGTGTGCTTCAGAAGAAAAACAATCAAGCATCCAG
GTGTCACCATACATACAGTACATGCTGTGTTTTGAAAGTCCCTTTTGCAATTCATATTATTGAGTCTAAACGACGGGCAACGTTCTCTAATCTACATGGT
TCTCTAGTTTCTAGGTTGTCGGGAGTGGTCGTATGAGCCTGGAGGGAGTGGTGGAGGTGGAGGCTGCTGCTGCTGCTGAGCGTTTGGGTAGTAACCAGTC
GGCTGCGGTGGGTACTGCGGAGCTCCGTGATGGTATGGCCGTGGTGGTGGCGGTCCAGGCTGATAGTACTGCTGTTGTCCTGGCATCGGAGGCGCTTGTG
GCGGGTAATGAGGCGGAGGAGGCATGTGCGGTTGCTGGAACTGGTGCTGCGGCTGGAAGTGCTGTGGCTGATGGTGCGGGTATGGATGTTGAGGTGGTGG
TGGTGGCGGCTGGTGGTGCGGGTTCATTTGCATCGGGTTGTATGGCATCGGAGGAGGTGGTGGCTGGTAGCCAGTTGGTGGCTGTGCGTACCCACTGACA
GGTTGACCAGCGTACCCAATGTGCAGAGGAGGAGCATTTGGCGCGACGTACCCTGGCTGAGTGTAGTGCGTGTGTCCACCGTGGCTCTGACTCTGGAACT
GCACTTGACCTGGGTTATGGTGGCTGTAGTTGGTTTCACCACGGCCACTTCCGCCACGACCGCTGCCGCGACCACCTCCGCCCCGTCCTCCACTTCCACC
ACGACCTCCGTACGAACTACTGCTGTTAGCATTTCCGACGCCTTGCCGGTAATCCGTAAAATGAGAGCTAGTGCGGTTGTTGGAGTGGTCTCCATCCGCA
GTGGCACCTTGCTGACCTGGTTCTGCGTTTCCGCCACGATTGCGCTTACGATTCAGACGCTTCGCAGCAGCTTCCGCCTCGTCGTCCGAGTATATCGCCT
CGTCGGTCTCTTCATCAAAGATATTGGATGCGTCCGTGCCCTTGTCCTTGATCTTCTCA