Description :
From Genome Similarity Track
Location :
Scaffold_435:22707- 27288
Sequence
4581 bases(100 bases per row)
ATAAACGTATGTCCACCGATATTATTAAGTTGGACAAGGTTTTCTTGTATTCACAGTTTCTTTATGTACTTCTATAAGTTTTATAGTTCATTCGATGAAA
ACGGAGCACAACTGTATTACGCAACTTCTTTACCAATTACGATGTAAAATAAACAGTGACGTAGACACAATACACCGCCGGTGACCAATGCTAAGCCGTT
ATCGGAAGTCGATCGACGACCGAGAGTATAGTAGTGACCGAGTAAAGAGCAATCCAACATGGGACGATCGTTTTCGTGGTGCCCCATGCCGATAAACGTA
CAGGATCCACGGGACACAATAACAGGTTTTGCAGTACAGAAGGTAGCGTCAATAAGAAAGGGTCCGTAACTAATAACTTTGAAATCCTATATATTCGATT
ATAGAGGGGACTATTTTAATTACTGATAGAAGTGACGTCAAGGTTCAAATTTCGCGCCCAAACTCAAACAGATCGGCTCCCTCACTCCCACCAAAAAGAC
TCAGAGCCCACAGCCGACATCGCCACGATGCACTGTGTGTGCCCTATTGAGAACCTGGCCTACATGTCCTTCAACACGAGGCGTTGTGTCTCGTTGCCCA
AGCGCGTCCGCCAGACCAAAGTCCAGCAGCCCCAGATTCCTGAACAGCACGAAGGATCCATCGCATCCCAGGGTACGTACCTGGTGGGGTCGATACTGGA
GCTCGAGTCGCGAAGAACTGCATTGTTGAGAAACCAACCGCAGTCGTCTATGATGGCACCGCAAAGGATTGGATTTTACAGTGCCTAGGGATTTTGGACA
AGGCGATGGGGAAGAGCGGCAAACGCATCTGCTGCTGCTAGACAAGGCCCCTTTTCACAAGATATCATACGTTTTGCCAACAAACGTCCCAGTCAAGAGT
CAAGATGCAACCTCCAAACACTACGGCAGTGCTGCAGACTCTGGACCAAGGAATTATTGCTTGGTTCATGCAGCGCTATATAGCAGCGCGTATACAAGAG
GCTGCACCCCACTTTCTGGACGGAAACCTAGAGCCGTACGACAGTGCGTCATCCGAGGCATTGAAGTAGATTTGTGACGCGTGGGGGGAGATGCCTACAG
AACAGTAGCGCGCTCGGTGCTCTGTTCGAGCTCTCTTCGTGCGCGAGGTCTCTCAGCTTACCAAACAAAATAGCAATTCATTGTTCAGTACTCCTAATCT
ATACTTGAATGACAGTGAGAGAGTATCCAGACGTCGATTTTGGTGCTACTCAACACATGTCTTATAGAGAAATCGCTAAATGAACCCACAGCAGCCTTTG
ATTTGTTGTTATCGCACTCAACTCCAGCCATGCATTACCCCCCAGGGCACATCGACCTGCACAGGGAATAATTCGATTCAATAATGAAACTAAGTCATAA
TGAACATCATCGAAATAGTTCGTGCATGGTACAACACAGAGGAGATGCTGGCGCTTGCCTTCAAACGGCAATGTGGATGTGCGGTGTGCAGGATGGCATT
CGAATGAGCTCCTCGTGGAAAATCATGCTCCTCGCCGAAGGTCCAGTCCGCATCGCATTTTCCTGGTTAAAACACACAGCATCACTACCGCAAAATTGCT
TCGTAACTCCTGCTACTTCACTGATGTTCGTAGCATGGTACAACACAGAGGGGTGCAGGCAGCTAGTTTTCAACGTCACTGTGGATGTGCGGTGTGGAGG
GTGGTTTTCAAATTAACCCCTCATAGAACACCATGCGCATTGTCCGAATTCCAGTCCGCATCGCATTATCCGTTTTGCTTCTCAAGCCGCATCACATAAA
CGGTATCTCAAGACATGCCACTTCATCCTTGAGGTCGCCATACTATGACGAAGCCTTCACAAGAACTTCATCCAACACCAATCACGGAAGTCGAATCGGT
GACCCAGCAGGATTGGCTCGGTCTCTTCCAGCCATCACCACAAGCAATGACGCGAACAAAGCACATCTATTCGCACAGCATTTGAAGCAACCTTTCATAA
TGACATGCCCCCTGTTGGCGGTGACTATAATGTCGTGGAGACACAGCAATGGCCACAAAACGTCTACCCCATTCCGAACAGAGTGTTCTCGGTGAACCGA
CCGTATCCAGTTGCGAGACGATCACCTGTTAATGACGTCTGCGGCTGTGACAGCCAATGTGTGGGAGACAGCGGGTCCACATTAATTAGTACGTGCTTGA
ACGTCGCCACGTGCTGTCGTTGTGACACCACCAACTGCTCCTTGGGTGAAACCTGCGGCAACCGTTTCAAGACGCGCTACGGTATCGACTTGATTCAGAC
CCTTGTCGGACTTGGTGTCGTCTGCTGTGGGCCAATCCCGCGTGGCGCCTTCGTGATCGAGTACGTCGGTGAAGTGCTGCTTGTAGACGACGCTGACAAA
CGCAACACCAAGCAATACCAGGCGGAACTTCGTACCAGAGCGTACTGGGTGGGTGGAATGAGAGTGATCATCGATGTGATTTCTAGTGGCAACATGAGTC
TATATATAAACCACTCTTGCCGCCCCAACTGCGCTGTCTATGAGTGCAACTGGACCAACACGTCGCGCTTGGGCATATTTTCGTTGAGCGATATCCCACC
ACTGCAGGAGTTGACGTTCCAGTACTGCAAGCTCAACCGGCTGTTCCCATGCCAGTGCGGCTGGCCAATTGTGCGTCAAAACAGGTAAATCTATAGCCGT
TGGAGCCGCTCATGATCTGCGTCGTTCGTCACGAGATTAAAGCATGCCATGAGATCAGGACAGAATCAAGGCAGCAAGAATGCACTGGATGCAGTTGCGG
CTGACCAAAAAATATATATATTGCCAACCGTTCACGTGCGCTTTTGCTCAAACAATTCCAATGCCTTACGTACTTTTGTTGTCATCGCTACGGCGATAGT
CTGACACTCGCTGCCACATCATTCTCCATCGTCGCCACATTTACCACAATACACTATCATCAATCCATACATCTCCATCTTCCCAACGTCGCTGCTTCTG
TGGTCACTCCACAGTAGTGGAGATACAATAGTAAATGAAAGCATTTGCCTACTCTGAGCTTGAAACTCCCTCCTTTAGTGTGCCCTGCTGCCACATCACC
AGTGACCACTGTAATCAATGTCGCTGCTTCGTCTTGCGGTGCTGGCAACGCTGGGAGCGTCTTCAATCACCGTTCAGCTAGATGATGGCGACTCTTGCTG
TTAGAGAAGCACAGCCATGGCCTCCCGACCACATACCCCCCTCCCCCCATCCTTCAGCGCCACATATAGCGGTGCTGGAGGCATTTCGTGGCGTGGTGTA
TGCCTCAGCCCCATGAGTAGCGCCACGGTCAGCATCCTTGCAGTAGCGGCATCCTCCCAAGAAGAGAGGGAGAGGAGAAATGGCGACGCTTCTGGTGACG
CCTCACAGGGTTATTTCTCATGTCCACCACGCCGGTATGTGTGCTGCACACCCACACATGCGGCACTCCCAAATCAGCTTTTTATATATGGTACGGCCGT
ATGATTGGCTCTTCCCGCCCGAAATGACCTGCTGAGGTAGCCCCACTGGTTACTTAAGCGGTTCCGTGGTTGCTCACTTAAGTTGATTACTATGCGCTCG
CTCAACAGTGAAGAGTCGCGACTGTTAACTTCAGCAACACAAATCAGCGCAGTACCGTGGTTTGTCGTTCAGGTTGTCAAAAGTTAGGGCTAAATAAACG
AGTATAGAAATATGTGAATTCCATTGACGTTGACATTTAGATACTCTGTCCCGTGCGGGATTGGGACTATTGTGAAGGCAGGATAGTCGAAGTTTAAAAC
AGCTCCAAAATGTTTAGAAATTCATGAAATCAAAGACTGGTTGAAGTTTCTATCCCCGGGCTCCGTTATGCTCTCAGCCTCAAGCTGAGAGAACAGTAGC
GCGTCTCGAGTCTCGGTCGAGTCTCTTCGCGCACGAGGTCTCTCAGCTTGCTAGATGAGTGCTGGCCGCTTGGATGTTAACGTTGGTACTCCTTGCTGAG
CAGTACGGTCGCTATGCTTCGGGTCGCTAATATGGTGCAACGGTTAGTCCGCTGAAATCGCTACTGCACTGAATTCGCTGAATAACGCGCTTATGCATCT
GCTGGCCGCACTAATTTGTCTATTTTGCTTACTTTTGCCGCAGAATATGAACGATAACTCGTCCGCATGCCCTACAGTCTTATATTTATCTGAAAACCCG
CGTACATCCGTCTTATTGCACAACTAACAAAGGTTCTTCCGTGACCTTAGATTGGATCTATGAGCGCAGAATCTCAATGAATTGTGATATCATTACTACC
GTCTTACCCCGCATAGAGCGCATGAGCACTCAAATAAAATAAAATAACCACTGAGCACTGTATTCGTTTACACTGCCTAGGCATTGTCGAGTGAACAAAC
TCACTACCTTTGAAGATGAAGCCCTTGAGCACAACTTCGACATAACATGTATAAGTATAGATGTTGGGTCTCAGAGTTCAATGTGCTGACGGCTCCGCTG
GTAAGATCATGGATTGGCGATCAGCTGGTCTATGGATCGATTCCAGTCATGTCAATTGAGGGCCCAATGTAGCGGGGCTAC