Description :
From Genome Similarity Track
Location :
contig_55:227051- 230033
Transcript NameFunction/comments
g10968.t1hypothetical protein

Sequence
2982 bases(100 bases per row)
GTGATGAAGTAGCTCCATTGGTCCTAACGCAACCGCGTTGGCGCCCTGTCCGGGTTGTAATGCGTAATTAAGGGAGTCCACCTTGATCACCGAATGGGCG
TCTGTCAGAGGCAATCGAGTCGGCCCTTCGGGGCTCACGATATGCAGGATATCGGTCGTTTCGGATGCTGTGTAGCCCGAAACGACCCCGTACGACCATG
CATCGACGCCAGCTGGTGATGTGTGTACGAAGGCGACCGTGTGGGCTATGTATGACCCTGGCCAAAGTCTGCGTTCAGCATCTGAGACCATGCGACGCAT
TATGGTGTCCTTTGGCACTTGAAACGTGACTAGCCGAGCGCCGCCCGCGTTGCGGGCGGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCA
GCTCGCTTCACTACTGTTTTTGCTATGACAGGCTTATGTTTTATATCAGTATATTTTACAGTAGACTTGTATCAAAACCCTAAGCCCGCTACGGCTCGCA
AGCTTCGCCTTCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTACTCGCTGCGCTC
GTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGTCCGCTACGGCTCGCAAGCTTCGCCTTCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCAC
CCGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTGCGCTCGCCTCCTCAGTATGTGTCGCTGCCTACGCTCTCTCGAACAGCTGTCGGTA
CACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGATCTCGACGTAACCCTTGACATGGCCACA
TACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCT
GGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGTCT
GTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGACGCGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGC
ATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATACCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGT
CCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGT
GGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGC
GGAATAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGAT
CGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGAGGTGGCAGCCGTGCGAACACG
CATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACC
GGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAAGCGTTCTGTCCACTGCCT
CAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCCGTGACCTGGGATCGCTTGTTGATGTTGCAAGT
AGATTCGCCGTCTATCTTCAAGGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATT
GCAATTTTCCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTT
CCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCGTTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGC
GTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGG
ACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGT
ACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAG
CTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTG
GGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCG
GTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCCTG
GTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTC