Description :
From Genome Similarity Track
Location :
Scaffold_72:22705- 49537
Transcript NameFunction/comments
Hyaar_Emoy2807963hypothetical protein
Hyaar_Emoy2807964hypothetical protein

Sequence
26832 bases(100 bases per row)
TCCGCTCACAGCAGTTGGATCCGGAGCAACATGCTCTATTTATACCATACGGACAGTTTAATATCATATATATATATATATATATATATATATATTTAAT
CGTCGAGTGACAAAACTGTTTTGTTCTCACAGAGGTTACTCACAGACTTAGTTTAAATGACATCTTTGTCCACTGTTTAGGGGAACACATAAATATAGAT
GTGGAAATTTACATCGACCATTTTCGATCAGTAATTGAGTGCATGCGCTCCAATAAGATATACGTTATGCTTCAAAATGCATCATTGGTGATGAGAAGAG
ATCTTTCTCAGGTTTAAAAGTGTGGACTGAAAGCATATCGTGCTAAGCTTAAAGCCATAGTTAATTGGCCAACTACTAAGTATTAAAAGGACTTGCGTAA
ATTGCTTAGTCTGGCTAATCACTTGCCAAAATAGCGATAGTAAGGCTGTCATGGCGAGGTTATCATCCAAATTCCTTTAGAATGGATACCTAATTGTACT
GGAGTAGCATTGAAGATGATGATTCAAAGCAGTAACGAAAAGTCGCCTTCATGCCTCGATTTTTGGTTTTGCAGATCCGGAAAGGCCTCCCAGTACTGTT
TGATACGCTTCATAATTTGCCATTGACAGTGCTCGTCTACAAACATATACGGAAGAACATGAGTGTACCATCGCTTCTAAGTACCATTAATTTAAAGCTG
CAACACTATCCATTTCGTGACAAAAACTATGAAGTATGCTCTAGTAAGATTCAAAGTGCGTTTCCTTGGATCTAAGCTGTTTATTTCTACATCGATCATG
CGTGATTACGAACTGGGGCCCAGTCTCAGCCCATCTCTGACAGAGAATGGCCCTCTGGATTTCTTTTTTCACTGAATATAAATTTAAAATGAAATATACG
CCAGAAAATCAAAACTCTTTGGAGAATTCGTGGTTATGCAGGCCAGATTATGATCGTTCCCATGTGACTACTTCGTTGTCGTACATCTCGGAATTGGTTC
GTACGGCTTATGTCCGTGTTGATCACAGTTTCACTTTTCTATGTGCTCTTGGGAGCGAGGAGTTGAAAAAGTCGGACATGGAATTGATAGCACGCTTCTC
GTGTTCGGTTATATCTATATGGTATCGATTAAGGTCCATTGTGCTATCGCAGAGAATTTGCTTCGTATTGTTTTTCCCATAATGATTAATTAAAGTATCG
GATCCTTTATGACGTACATGATGCTGCGTTGAGCGGTCATCTTAGTCTTGAGTAGAATTATCGCTTGGTGAGTCAGAGGTATTGGTGACTCAAACTCTAT
AAAAGGGTAGAGTGCCTGTGTACGTACGTGCGAAACGTGTCATCGGGTAAAACCCTCCTAACAAGCGTCTACGCCACTGGTGATTCTAACTGTACCTATG
GGGAGTTGGAAGTCGGTTAGAATGGAGTTTGTGTTTGGCCTTTCAAAGATTTGGACAAAAACACTGATATCGCAGCCTTTGTTGACCATTTGAGCAAGAT
GTATTAATTAGCGGTTGGACCGGACTAGTTTGTTGGTGAAGGCTCCATCTTTCTCTTCGATCGAGTATTCGTCAACACGGTCTGCCTATAACAATATCTC
TAATTGAGACCTTTGGTTGACAAGTAGCTTTTAGAAGTCCAATTTCTAGATTCTTGGCAATCGTTTAATAAGGTCCACGTCGTGTTTTTTGTAGACCGAT
GGTCAAACAGAGATCATTAATCACATTGTTGGAGATATTATATGCAGCATGTGTGCTGATGCACCTGAGCGTTGGCGCTTGATGCTTCTAACTGTTGTGC
TTGCTATAAACAACTATGTACATGTCTTTACAGGCTGTACGTCATTTTCTAAACTTCCCACGCCCGCGCTTCCCGTTAACGCTCCCACACCTTCGTCTTG
GGCTTTATGGTAGAGAGCTTGATGATTCGCTAGCTGATGTCACCCCAACCTTTTTTCAGAAACAGGTCTACACATTTCTATCTACACGATTAAACGACTT
CATTCATGTGCGTTATGCCATGTCTAAAAGCCACGATAAACAACAAAAACTAACACTGCTAACGGTACGGGTGCATAGATTAAGGTAAAGGGTGCATAAA
ACACCATGAGGTCGGAGACCAAGTCTTAATAAATTCTAGGAGCCTACCTACAAATGTAGTGTCTACAGTATTTAAGAAAAATGTGCGCTCGCGCCTTAGA
AAACCCATTCAAGGTCATGGTCACTAAAAGCCTAGCGTATACGGTAAACTTGCCACGCGAACTTTGTACACAACCGTGCTTTATTTTAAAATGCTTAAGT
CGTATCTGATACTGACCCACATGGATGTAAAGGCACCCATGCCGAGGGCGTCAACCGTGCCGCTGGCTGTAGCATACATACCGTGCAGTCCTTTAGCGTC
TTCATCTGAAGTTGCTTTCTCTCCGACGCTTGCTGACGCGCCTGCGTCGTCGCAAGCGCGCTATGAGTATAAAAGGGTATTGCAAAGATTTTTCATTTCA
TGAATCAACCCCGAGTGGGCTATCGTTGATACACGGGCCTCCGTTGGCATTGCTTGATAAGTAGAGGAAATTTCAATTTCATGTAGGCAAGAGTTCTCTA
TCGTCGTAGCCTTCTCGACCAATAACAGCGTCTGGTGAAGTGGCGTGGGTTCCTGGAGTCCAATAACTCTTTAAAGTACAAGATACACTTTCAGTAATAT
TGTCAATACGCCGTGGATATTTCTTAACACCAGGGCGAGGTTCAACTTGCGACCCAGGTTGCGTCCCACAATTACTTGTGGGACGGGCGGGTCCATGACC
GAGTCTGTCGTAGAATTGTCCAAAGCATTTCTTTGCGTGGCTGCAGGAGACACATAGAACAAGCTCGACTGGAATCTGTCTTTAGCGTTCTAATGTCATA
TCAAAGCTTGCGTTCGAGACGCACACCAGACACATTGTCACTTGCTCTTTCAGCCAGCATGCATCTTAAGCGTCATGCTTTATACTACCAATGGACAAAC
GCGTTGTCCTTTTCTGCGCTTAGATCCTGCAGACAAGAGAATCGGTTACCCTTTTAATTGCAGGTACCGGATTTCCATGTGGGGCTATGTCAGCCCAGCA
ACATACTTGCTTGCGTCAGAGTGAATGGATTTAAATACCTTTCTAGAAGGGACTCCCGCTCGCTACCTCAGCAGCTATCTTAACCTCAGGACCTATGTTC
ATCAAACTTAAGCTTTTGCCTACCGCCTGTTTAATTTGCTCATGGGAGGCGTGTAGATGTCAGTCTTTACTTCTTTGGATTGAATCCATGATCATTGAAC
GACCCTGATCGCGGTTCTCCTTAACGACAAGTAGCTGTTGATGTTCATGTAGAAAAATTGATGAAGATCACAGATGACGTGTTATCTTGCGTCATGCATA
ACACATTTATCGCATAGCGGCACAACGTTCCGTGTATGGATTCCGTGCGCGACGAGATCGCCGTCACACATAGAACTTCTGGGTTTCGATTTCCCCCTTT
TAGATCGTTTTCAGTTTCGTAATCCACCACCACACCTTAAACTCCTCCAATAAACCCGTTAGGAGTCTTCGTCTCTTCACCGATTGGCGTCTTGCTTGCA
TTCATGCACTTTATAAAAGGGTATGGTACGGTCGTACAACGACCATAGCGAGGAAATGCAGTAAGTGGCGTTTTGTAAAATAATGTCAGTCTGGTGGAGA
AACACAACGGGGTCACACATCAAACAAAGATTGATTTAATTTGCTCGAAGAGATATTGGGTAATTTCCATTAAAGCTGACATAGGTGGTATCGTAACCTA
TCGATTGTCGTTCCAGATCCAATACATTAGTACTAAGTACGACATAATTTGATAATTGAACGTACTATCATCCATCAAAGTGTCTAGCAAAAAAGGAATA
TTGTAGTGGTGCGAATAACCTTAGTGTTGGGAGGCTATGAAAAAGCTAATTAGAGTACATAAGTTATAAATGAAGTTTTACCTTGTCTTTAGAATTGTAG
CAAGAACATGTCCCTTGGGACATGTTTCTCAGAGATCCTTGTGCATTTTATTTCCGTCTGAACCGTCAAGCTAAGCTTTTTGACTGTATAATTCTTTCTA
ACTCTTTAAACAAGTATACTTGTAAGTCGACGCAATTGGTTTCTCAAAAGTAAGTGGCTGTAAGCTATAGCCATCCTCTGACTGAGTGCTGTATATCCAG
CTACACCGGTCTCATTGGAGCGTTGTTAGACTACACCATTGTCCAAAAAACTGTACCACCCATGATTTGCTGTCTATCGCTGCGACGATTGAGCATTGAG
ATCTGCTAATTGGATATGATAAAAGTGTGATTGTGTTAAACATAGTACATGTGTAATCGACCCACTTTGAGCAGTTTGTAGAGGATCTCGTACATAAATG
ACGCAATTTACAGCAGTTTTTAAATATGAGCCAATCATCTCCTTACAAAAATCAAGATCAAATCGAAATGATGATTTGATAGTGTTTTATATGAATTTTT
GGCATTCTGCAAGCCATAGGAAAAGAAAAAGGAGCTACCAGACGAAGATCGGGGAAGGATCTGAAAACTGAGAGATGTCGGACGATCTGTCAGGGACATC
TCGCGACGTATTAAGTGCTCGCGCACTGATGCAAACCGCATTTTAGCTCCACGAAGCCAAGAGTAGAAGGGTACGAAAAGCTCTTTTAAAAAAATCCGCT
ACATGCCACTCCTGGTACAAGCGGCATCAACGAAAATTTTCACTTCCTAACAATCCTGAGCTCAGGTGCTCCGCTGACACCAACCCTGCGTTCTCCAAGG
TAAGTACTAATTTGTTTACACGAAAAATGGACAGCACCGTTCCTCTGAAATAGTATCACAAAAAGAGCGGTGGATTTGGGCCCATAGCCACGTGAGGATG
GAGTAAGACGCTGTAATTTTAATTGATGAGAAAATGTTTTATACCGGTGACCCTGATGCTTAATAGAACATTTGGCTTGAAATGCGCTTCTTGCTTCGTG
CCACCATCCGCAAACAGAACATTGGTGGGTCGGTCATTAGTTGGGCTGCCTACAGCGCGAATAATTATGTGGTGGCCGTGCTCACTAGGAGGCAGTCATC
TGAGCACTATGTCGACACACTATCGGATTTCTTGCTTCCAATTTCTCATGTTCACTAAGGGTCCAACTACACATCCTAGAAGGACAAACGCATCGATCCA
ATGTCGGAGTTATACCGAGTTTTTCGATGAGCAGCAAATGTAGGTAATGCAATGGCCAGCACACTTACCCGATTTGAATTCGGTAGAAATTGTGTGGTCG
CTCTTAGCCGCAAGAATATGTACTAATGTAAGCAATGTTACAGCGTCATCGAAATTCGTTTAGCTGTATGTTCTGAATATACGGCTATCGAATGGACATA
TTACGCACAATCGTCGACTCATGCAAACTCTGCATTGAGGTCATCGATGTGCGTGGTAAAAGACCTAATGTTGAACGGAAGCAGTCTATTTGTCATATTT
TAATCTTGATTTTTGTATGGAGATAGGTGGCTCATATTTTGGGCCAGCTGCAAATTTTGTCATTTGTATACGAGATCTTCTACAAGTTGCCAAAGCGGGT
AAATCACACATGTACTATGTTTAACGCTATTACACACTTATCATATCCAAATAAAAGCATTCAATTCTCAATAGTCGCTGAGGTAGACAGCAAAACACGG
TGGTACTCATGTTTGGATGAGTAAGTATGTGTTTTATCGATGAGGCTAGTGACAAATAGCTTGTCCAGTCATCTATTTGAAAAGTGACCTCACCAAAAGA
TCGACATTGTACAAGAGTAACATTGTCGTTAGCCAAAATGATATGCATAAGATAATTGAAGTGTTTATAAATCACTACATTTCATCCGTAAAACCTGATT
AAACTGATAGTATACGTCTGGATGTATTTATCAGAGAAGGAAGTTATTAGTTAAGCTAGCTTCGCGGCAAATCGCAGCAGATATTGAGGACGTGTGTGGG
ACAGATATTAAATAGCGGTGAGACAGGCTATTCGATAGATAGTGACATGTAGCCAAGGATAATTGTATTCCGTACCGTAAGCGCTACAAAAGATTGTTCG
CGAAATCATTTGCTTGCAGATGACAATTTATATTCATATAATTCGTAAAGGCTCCGCTAAAGCTACAAGCACTAAGTCTTCGGCCGCTGCCACAAATAAC
ACGGCCGCATACATTTGATCCTGCCAAAACCACAGCTCAGAAATTTGTATTTAGCTTAAACAAACAAATATTACCCTTGTCGTATCCAAAACTTTGATAA
TGGACTGTATCATCCATTGAAAAGCTTCAAGAAAGAATTGTAACATTGGGTCGAATTGTAGACCTGTACAATCCGATCGATAAAATAAAATGTTTGACAT
TGAGAGTTTTAAGGATCGATCATCCATACATAGTTATCATTGTGTATTACATAAACATAGACCTAATTTAGCGAAAACATGAGTTGATAAGAACCAGTTG
TCCGCTTGAGCAAGCAAATGTGAGATTTTATCGAGCACAGTGCAAAGTGACAATCACTTATCTGTTCTTCGAAGTGAAATAGTAGCTTGAAGACAGGAAC
GATGACGTGGTGTAGGTACTGTGAGCGCGTGTGTCACTCACGCCTTTAAAAGATACGTAACGTGCTTGCAATCACAGCAAAATCATTTTGTCAACACAAA
TGAGAGGCAAAGGCGCATCAACGAAAAAAAATCTAAAAATGTTTGCTGGACCGCATGATAGTAATGAAGTTTTCATGTCTTTAAAAAATCTAGGCTTTCC
AGTAGCTTGAGGATCTTGTACACAAGCGCGATATCTTATAGCAAATGATGCATAAGTTGGGGCAATAGTTTGCCTTATTTTTTCCAGTCTGCATTTTCTT
GTATCGGTGCTTATTGATGTATCGTACCGAAAAACTTCCATTTATGGACCCTCTCTTACCTCTGTACTTGACCTTGTTGCTGGTTCTTGCTCACCACATA
TGTTTGACGTGAATCCTCGGTGCGATCATGCAAAATGTTGTTAGCTCTCTTTTTGTTTTGCTAGCTAACACACAATTTCTGAGTTTTGATTGGCTAGATC
AAATGCCTGAGGCTGAGGTGTTAATGTCAGTGGCTGTATATGAGTGTCTGTCTCTTCGTATACACATATGCTTAAATGTAGGTGATAGGAGCTGCAGAGT
TTGTCAAGCTTGTTGAGCTTCCTTGTACAGACCTTTGTCCGTCAACCCATCAACTTGGTTGCATAGCACACTCGGTTAAACCTGTGTAAATTCATACTAT
GGTACCCGCTTCCTGTCGGCATATGATAAGTTGTAGCATACCCTAATGTTACTGCCCGACGTTGAGACGGAGGTAAATTATTGCTGAATGCAGCTAATTA
TTTTGGACAGTGCTATATAAGACAGGATCTACTGTAGTATAGCTATACACACCATCAGATTCAACATTCAATCACAGATCAATACTATCATCAAACGTTG
TTGAACATGTCCACGCTGACCTGGATCGTACTTTCCAATTGAATTATTCCGTTTCTACTGGAAAAAGACCAGAAAGCATGAGTACCAGCTGGCGACTGTT
ATCGAGAAGGCAGCAACGATGAAGTAGAAAGATTGGAAACGACAAAACATAACGGTGAGCATATTTGTCAGGGGTAACGACACCATACTATCAGATTTTA
CTATCCTACACGAAACAAAGTTAGAGCCTACTTCGACTTCGGTATTGGAATGACCCATAGCAAAAAAAATATATACTACGTTCGAGTATTCTCGGCTTAT
TCAAAGAATCAGTCAGATTCACACAAGTTGCAGTCAAATTAAAGAGCAGGCACGCCCTCAAGATTAATGGTGGCTTTATAAGGAATTACTCTGTGCGAGA
GGAGTAAAGTATGAAAAGAGCAATAAGCTGTTAAAGTCCCCACGCGCAAGTTGGCTTTTCAGCTTATTCGATGTGTTTGGAAGGCCTAGGTCTGGCGCGA
ATCAGCAAACAGTAATATGCCGTGACGCCTGTCTAATGTATCCAATATCGTTAAACAGTAGCCATTGTACGAGTGTTTTCCGTGGCCCGCAAGTCGTTCG
CGGATGATAGTAAACATTTATTGCGAGGGCACTTCTACCGAGGAAAAGGGAGCTAACATCCTTGGGGCTAATCAAGTATCTAACTGAATGTGGACTTATC
GTGTCAGAAAAAATTGATCGCTTAGGACCAAAGTTCTAACCTTATAAGCGTCAATACAAAGTCCGCCTTTATACGCAGGACTGAAGCTGACGTAGCCATG
TATAGTACGAGGTAGACAGCAAAAATCGTTTACACATGATATGATCGCTGAGCGTTATCCTCATGATAGTGCAGCGAAGCAGAAAACCCTTTTATTGAAA
TAATATGTTTATCAGACGAATAAGATGGCATAAAGATGCGCCAAATCTTCACCAGTCTTAATCTAACGAAAATGCTCACCCTGGTCTACTGTTTTATAAG
TTCCACGGTTAAAGCCGATTACGAAGGGTATTTGATACATGTGACGACTTTTTACCACTATAAATTCCAGGACTATACTAAACGTGGAGCAATCATCAAA
GAAAGCTAATAACAGCACTTTCGACAAACCTCACACATAATTGTGCTCTGCGTCTGACACATGGTCATGCATATTACGTCTCATCACAGCGAAGGTTTCC
TGTCCCAGATAAGCCGGCGAAAAGATGGTGTTCGCGCCCGACTTTTTCACCCTTTTCCGTGTCGCGTTCTGAAATGCCTTAATCATGACTAAGCCAACAT
ATAGTCGCGGATTTAGGATAAAATTCAGCATTTATGGCTCGAAACATATAAGAGATATTGTGTGAGCCATAGATTTCGAATGTTGCGATAGGTTCAAAGG
AACCCTCACATGATAAGAGGTTAGACACAATAATCTGAAAAGAATATTGGTATTGAAGGCCTGGCATAGAATTACTACAAGCTGAAGCAGCGATCCGAAA
GCCATTTAAATGCGGCAAGTATGGCGTATGAATGAGGTCTCCAGCCAATATTAACAGCATTACTCCAAGTGCTTAGTTGGTTTGTGTGAAGCAGAACCAT
TATAATGAAACAGGGAATTTAGCGCCCAATAAGAGCAGTGGTGATTTCTGAACACTCAATTGCAAACCGTGTCAGATGTCGACCGAATCAGCCGCAATCC
GCTTTTGCGGAATGGGATTGTTATGTCACTTGATGTTCGGATACCTTGGGTCCACTCCGGCCCGATCTGGGGAGGTATGCTAGATCCACAACGGCCCTGC
AACCTAACCATTCAAATTGCCCAATAAACAAGACATTAAGCATAAATGTATATAGGTAATCATGGTACACTCCTAACTGACGGAAGGTAGTTGTCACAGA
CCGAACGGAATAATGATTGACACGAAAAAATCATACCAGAATCGAGTACCAAGGCGACGGGCAATGTAAGGTCATCTTGTGTCACGCGTGGACAAGCTAA
CCAGAGCAAGGATGTGCAATCCTGGACGGACTATTTCTATATTCACCAGTCAATCGATTGAGTGGGTTTATGTGCAGTGCTTTTAAAAGAACCTTTGACC
CAAAGGATCGGGTTTGATTACTCGTATCTTGTCAAATTATCGACCAAAAGATTAATTACTGTCGGATTTATCCTGCGAAGACGAAGAATTAGGCGGCGAC
AAATTCCATGAAATCGTATGTCTTAGAGAAGCAATTTACTTGCCTTATCCACGTGTTTCGTACATACAGCGGTGGCGAATATACGATTCTGGATTTATTC
TGCAAGAGCGCCGATTTGAAAAGACAAGTTATGGAGGCGCAACATCGATCATAAACGACAAGTCTGAGCGATTGTACCGTACCGTGACGAACATGGCTCG
ATACATGGTACTGATAGCGATTGCCGCTATGTTTATGGACAAATGCTATAAATTTATATACATAATCGGAATCTCACCCGTATTAACCCAAGCAGAGCTT
AACCGATCGAAGTTTTGGCAGATCTATCACCGGAATATATGAGGAATTGTGGTGTTTGGGTTGCAGTGCACTGTGTACCGCGAATCGCGAAAGGATTATT
TGGTCGAGCACAAGCGTGAACGATTATGGAGAAAAGTGACGTAACGAACGGTAGAAAGTATACCTTCGCAAAGCAAATGTCATGGTTGTGACTTAGCATG
TCACCAACATCGATAAACCAAAACGGAACAAAATTAACTGATTTAAAGCAGTATGGAATATAGCGACACAGTACAGCATCTCAGAGACCTCGTGACGCCC
AAGAAAAAGGTCAACAAGACGGTTCAGCTGGCTTACGCAGTCGAGCTCGTGAGCACAACCGGCGACGCCTCCATCACCTGCCGCTGCATGCTCTGTGAGC
ACATTGGCCGGGAATGGTCGAGATTGGGCCCACCATCAGCCGCATGCGCAAGTCCTACAGTACCGTCAAATATTTCACGGCGCCGTTTACCGCAGCGAAG
TACAAGAACCCCCATATGGGCCAGCAACAGGAGGCCTGGATCGAGTACCAGGCGGCATTGGATAAGGACAAGAAGATGTTCTTCGACGGCCACCTTAACG
TCAGCGACACGCTCCATCGCTACATGGACCTGGCCAGCAACAAGATGACGTTCAAGGTCAAGGCCAGTATCGTCTACGTGACCATCGAGGAGATGGTCTT
CCGCAATGATATCATGATGGATTTGGCGATGGAGACAGCGACGACGAGGGCGCCGCGGCCAAGAAGGCGGCCACGATCGCCCAGCAGAAGATCAACACAA
TGAATTTGTTCGTGCAGAGCGACGCCGATTCGATGTGGTACTCTTTCACTATCACGCACGCTATGCACTTCGAGCTGGCCATGGACTTTGTCGCGATCGG
CATGTCGTTCAGGCAGGTTTCGAAGGCCATCGAGCACGCCAAGATCCGGACGTGTACGACCCAGCTGACCGGTATAAACGACCTCATTGTCAGCCAGTAC
GCCCGCAACCTGGTCGGTATTAGCCTGCAGCACATCGCCGACCTGCTTGACCACGACTCGGTCTAGGGGATATCGCTGGATGGCTACGGCAGCACGCATC
AGGGCCAGTCGCTCTTCGACATGCGCGTGCGCGTTTGCTTCGGCCGCAAGATATTCAAACTGCATCTGGGCTATCCCGATGCTCGACAGTCACACGCTCG
AGAACATCTTTCACATGCTGGAGAAGTTCCTCGACGCGCTCTACGAGCCGTGGCGCGCTAAGCTTATCAGCATGTCGGCTGACGGCGTGAACACGATAAA
GGGCCACCACCGCGGTCTTGTCACGCGCATGGTGGAGACCGCTGAGAATCCAGTTGTCCACATATGGCGCTTGCCGCACCAGATGGACCCGGTAGTCAAG
CTGGCCGCCGAGTGTGTGACAGACAGCACCTAAATCAAGCTTGCCTGGTCCTTCTCGGTATGTCTGCGCAGACGGGCTAGCCTAATCATGGGCGTCAAAT
GGCCTAAGAAAACGAATCATTGTACCCATATCGGTCGCTGGCTCGCGTCTGTTGAAGGGCTTATGTCGGTAGCTGATTGCGTTCGGCGTTGAGAATTGCC
CAAAAGCCACGCCGACCTCCGAGTGGTGTCTGATCACCTTCAGCTATGCACCAGTCATCGAATCCATTAACCTGACGCTCGCCATCTTGCAGAGCCGGTG
GCTGATTATAGCACAGCAGGAATCGCACATCAACGCGCTCGTCGGCACACTGACAGCCATGTTCGATGTCGAGATCGTGGATCAGGTCGATTCCTACGAT
GATGGCATTGACGTCGTTTACGAGTTGTTTGGGTCCATGCGCATCCCGGTCGATTCGATCGTCGCGCACATCTATAACCAAGACTCCTTCGCCACGACAT
TCTACGACGAGCTGGACCCGGCCGAGAAAGCCTTCATTGTCGGCAAGATCGCTAAGTACAATACCACGGTGATCACGGGCCTAATTAGCATTACAGCCGA
GCGTGATGGTGACGCATCTTGACCAACGAACTGCTGGAAAGCGACTCGCCGCCGGTGCTTCCCGACCCGTTGGTCAAGAGGCGTCATAAAGTTTGGGTGC
GCGATGTGTTGACGCCGCACCGCGACCACGTGGCGAGGTTCTGGTCAAACGAACAGATCGATCAGCTTAAGGTGGGCCACAGGGAGCTAATAAAGCGATA
TAGCGACGACCCGGCCCTGCGCGCCTTTATCGACTCGCACGACGTAAACATGTCTTCCGACTTCGCCTCGGCCGACTGTCCCGGCAAGTACGACCATTTG
TGCACCTTCAGTGGCGGCTGGCCACCGTCTTCGCCAACACGGTGGCGGTCAAGAGCGATTTCTTAATACTCAAGTGGGAGATGGACGAGAACCGCACTAA
TATGATGTACCTGTCACTGGGGGGGGTCTTCCAGGCGAAGTAGAATTAGCTGATGCCTTTTTTATAAACATCCTTCCAAATTTGCACAGCCAGTGACGAC
AAATTAAGCTAATCTGTCAAATTTATTGTAAGCGACAATAGTAGGAGGCCTAGTGTTATATCACTATAACCGGATTTTTTTAAAAGTCAATTTGACCTAA
CAGGTCGCAATAGTCCTCTTGTGTTCTTTAGCGCAAGATTCTGCCAAGCTTTGCTTGGAACATTTGCGGACTCGAAGCTTCATCCATAGATGCGCGCAAT
CGCAAAAGTTTCTTAATGATAGACGCCTCTACAACTTCAAGCTATCTCCATCGCACTTACGGGCAAAGGTTTCTGCGCTAGTGAGTGATAAAACTGCTTC
CTTATTTATCCTTCATTTTATAGCGTATTCTGTTTCGTTCGTATCGCGTGCACGCGACGCGAGTTGTACTTTTTGTCCTGTATGTTACTATATAGATTCG
TATTTATATGTGCTTTCCCGGATCTGTTAATGTGCAATGTACGCCCGCATCAAATCATTCAGGAGGACATAAAATGGTAATGCAAAAAAATCTTATTGAT
AAGCGCGCGCTTGAGGATAAAACGGATGCTTCTAGTATCACGAAGATGTTAAGGCACCGGAACAAGTGAGATGCTGCTTTACGATAATCAAGTTGCTAGT
GCTGCCAATGAAGCCGAGGAAACTGCATGGTCGTGTAAGCAAGAGTCTGTTGCAGTGATGCACGAGTGATAGCGGCTACAACGTTAATAGATTCGTACTC
AGGAATGCAAACAAAGTTATTTTGATCTATAAATTGGTTCCGTTCATTTCTGTAAGGTTTTAGGTTTATTTGGTTCGATTAAACTTCCACCTCGTCGTTC
ATTGGGACCTACCATCCTGCAATGAGTGCATCTTCTTTTCATGGGTACCATCAAGGATGCTGCTACAGTCTCGAATTCAGACGGAATTCTGCGCATCGTC
GATGCAGATGGTAGACTCTTTCGGGTAGATCTTGGTGGCCTCCCACGCATTGCACGACGCCTTCTGGATTAAGTACATCGTTTGTGTAAGCTGGAGTACC
GTAAAATGATTTTAATCAAACGGCGTTTCTTGTGATACGATGTTATACGTGTATACGATTCCGCTACCCCCTTGTAACACACTGGTCATAGTTATCGTAT
TCGAGATAATGCCCGAACTCGGGTTAACCCTGGTTGAACTAGCCATCAATGCTGATGTAGATCATTCATCGCTAGTGCTTATTTACCAGGATATTGGAAA
TTTGGATCAATCTTCAGTGACGAACAAAGATTTCTTACCTAACTGTTCTTGCCGCGCAGCTGAAATCGTGAGCACACAGAAATTCTATTGTTTTCCTTTA
GAGTCCTTAACATTTTTCTGCCAAATTCCTTTTTTATAGATAGTTCGTGTGCGCGCCCCGCAGGGCTGCCACTGAGACCTTACCCGTGACAGCAGCGAAC
ATGGCTCCAAGCTCCATGTCGCCAATAGCACGTTCCCTGGCCTGAAGCTGCCTTACACTGACAATCTGCCCAACACTTTTCAGCTTGACAGCTAAATCCA
CTGACATGCGATCACCTACGAAGATATATAACATAATCAAAGACATCATAAAGCCATTCTCAGCAGTTCATAATTTCCTACCTGTGCACACATAAATCCA
TTTGACAAAGCCACATGTGCACTTTCCACGCGCGGTGTTAAAGTGTGCCTATAATATGGGTAATTGCGTGCATCCAAGCATTGACAAACTTTTCCTAAGT
TATAGTGAATGAGAATATTTGTTAGGTGAATCAAGTTAGACTAAGCATGTTATAAGCTGTTACCTTGTGCTTTTAGACATGTGCTTGCCAGATAATGCAT
GGTTTACCCATGCAAATGTCCACGCATTCCTTGAGTTAGGATATAAATTCTGGTCTAGTAGAAGATTTTACTAGCATTTTTCAGTCTCAGATAAATTGTA
AAAGTACTTCTGCATTTAAAAAAAGGCCGCTGGTTGGCAAATATGTTTTTGCTGATATGTCAAAGGCATAACAAGACATTTGCTGTCAGAAACGTTTCGG
AAAGTGCAGTCATGAGTACCAGTTCCCGGTCCGTTACAAAAGTGAGTTGGTGGGTGATGCCCCAGTCGTAAAATATGTCTTTCAGCTTAAATCCTTCAGA
AATAGTCCGCCGTTGTCTTCTTCTCCTAAAACAGTATCATAGGGCAAATACGGTATTGGTTGAGGTTATATTAACCATACGCAATATAGGGAGACCGTAA
CGATTTGTGTTATGGGTTGTATCAAGCAACCAAACACTCCCTTTGCTGAACTTATAGCCAATAACGCGTGCTAAAGGCGACACAATGAACAGATGTTATA
GCTGCAGGCTTCCAGGAATTTGTTGACATGGTACACCACACCCGTTATCTCGAGGTCGAGTAGTGCTCAACGCGGTGAACGGTTAGCAAGCATCTTGGCT
CTGTGCAAGCGACGGACAATGTCGTTATGTTTAAATGAGCAGTCAGGCCAGTGTGGTAATGTCTTATATAGATGTGAGAATGCGTCTCGGTTGAACGCCT
GCATTTATAAAGCTATAACAAATAAGGCAATTCTCTTGGCGTTAGCTCCATTTCCTTCAGATGAGCCGAAGGGTGTACAAAAGATTCGTGATTACGGTGA
CCTTCCACTGAGTTTGTTGAGTTTTAACTTATAATTCGAATATGGAATGGACACCCTACTCTGTGGTTGACGGATATGCTCATGCAGGTACGACCATCGT
GTCTTATTGCGGCTCCAGCCTGTGAGCATTCGAGGTCTTGACCCTTCACGTCTCCATCCATCCGGTTTCAAAACTCCACGCATTACGCGTACTGGGCAGC
CTCGTTCGAGCGCTCGTGCGTCTATTGCCTGCTTCACATCCCCCAGTGTGCCATAAGCAACCGCGAGAGCGTTCGTTGTCGTACACGTGTCGATAAAGTT
ATAATGAATAGCTTCGAAAGATTCTGTAAAAGATAAACCGCAGAGTACAGAAGTGATAAATGTAGTTTTTGTGGTCGATTTAGGTAAATATTTACGGATA
AATTATCCAATCATTTAGCGTTAAATCAAACCTAGCGGATCGTACCAAAAACTTAGGGGGATTATCGGTTCCCTTTATTATACAGGAAAAGAGTAGATTT
GAAACGGAAAGGTTCTTTTACCTTGTTTTACTACTAATCTTAGGACATTTTCAATTCTTTTTTTCATTTGGAAGCGTGCTGGCTTAATTATACTGAAGTG
AACCCAATACAAACTGCACTCATCATACACGCAAAAATGACACATCAGCCGGTTGACGCCACCTTCCACCAGTCTCATGAAGAGCCGCTTAGATGGTCAA
CTATAACAAGCGAAGATAAGTTTGATAGGTTGGACACAAGACGAGTGGTTCAAATCTCGATGGAATCAAAGGAGTCATGTATGGATAACAGCAAGCTATG
CTTCTAGTCGGAGGCTTACTACTCCACAACAAAGCTAGTGAGATTAGAATTTTTAGTTGTACGTGACCGACGTGTGGGTGTATCGGGCGCTGTCTAAACC
AAGAATTGATGTGTTTGGCGTCTTCTCGGAGAAAACTGCAAATTTGATATTAAAAGAGCGAAAGTTTAGAGAGAGGGAGAGGTTAAACGCATCGGTCAAT
TGGGGGTCGTTGCACCGGTCATCGAGTTTGGAATGTTATATATAAAATTCAAATTATAATTAATACCAAATCTAGTTCTGATGATACGTCCTGAAGTTAA
TATACCGACTAATGATCGTTTTTAATCGAATTTTCAATGATTGCGATTGATGGAAGGCGATGAGCTGCGAAAGCCGAGGTAATGAAGGAGACGCAGAGAG
CAGCCATTGAACACACTCAATAACATTCTTTATATTGTGGTTTCGGTTGACATAACATATTATCGCGGAGCACACTGCACTTATTTCATTCGTATAAAGG
CATGCCATTTAACTATCATGTCTTTTTTATTGCAGAAAGGGCTACATTTGTACTATACTAAACTCATTTTAGATGGCAACATTGAGGGACCTGGTCATTA
AGTATGTAGAACAATTTTAGTACGCCGCATTTGTTGTTGATGCGGATAACAACAACGTCGGCAGCAAAAACGTCACTTACAATGGAGAAGACACCAATGA
AGCCAAAGACATTAATGAAGCCAACTCCAATGCAACCAACGCAGAGGGTTTGACGAACAAAAGGCATATTAGAAAATTCTTTAAAGGAGGTGGACTCATA
CCTACTTTTTCTGATTATAAAAATAAAAGGACAAACATATTGCTAAATAGTGTGCATATGCACGCCTCAACAAGTGCTGTGTGCTCTGCATGAATATCAT
CACATCAACAGATCAACACTATACAGGCTATTGTTGTAACGGGGTTACACAAACGGTTGTGATAACCAGGTACGCTGGTGCGATATACACATAAAGAGAT
CAGTGAAAATGATAGGCGTATTATTGTATCACATACGCTAAGCGGTAATACAGTACCTTATCGATTACGGATAGATGGTATCTATCGTCAAAGCACGGCG
TATTTATGGTGTGGTAACACCAAAAGAACATCTATGAGGACTACTCGATTAGGTAGCATAGTTTAAAGGTTAAATCCGTAAATGAGGTGTATTGTCGCTA
TAAATCAGTAAATATATTCAGCTCTATTTTTGATCAATTTCAGACACGTGTCTTTTGAAGACGTCTCTGGTCGTTAGAGTTAAGAGCCTACATGAAGGGC
TAGTACTCTTTGGGCATTAGGTCCACGTTATTCCTTGGAGTCATTAGGTATCGTAAACAGGACTAGCAGCTTAAGAGCTTGTACATACACTTAGAGTTAA
GTCTCACTAAGTCTGTAAGGACTTGAGACCCTTTAGGCTAATACCCTTTAGGTTGATATACTAAGAGACTCTACGAGTCAGAAGTCTTCCTATGACAAAG
GAGTAAGGGTAGCTCCGTTACAACTATGGAGTGTGTTTAATAGCTGATCTCTGCATCTCCTTCACTACCTCGGTTTTCGTAGCTCATCGCCTTCCAGCAA
TCGCAATCATTGCAAATGCGATTTAAAAATAGATATGGATCGGTATATCATATTTAGGATTGTATCATCAGAACTAGATTGGGTAAAACAAATAAAAATT
TGAATTAATATATTTTATTGGCCAAAACAGATGACCGGTGCAATGAGCCCCTATCGACCGATGCGCTTAACTTTCGCCTTAGGGAAATAAATGTAATCAC
TCCTGAAAAAATTATTCGTAGGATGCGTGTGATTTACGGGAAAGGCGTGTGAATATCGATCTGGCAAACGGATGTGAGTATAGAAAGAATTGTTTGAATG
TCGAAATTTTGCAATGAGTAATAGGGTACGAAATGGGCTCGATAATTTATCGGTAGACCTTGCTCAATTTAGGCTTAGCGAGTGAAGTAGTTGTCACCCT
CTCATTAGGAGCAATAAGCGTTATAGTTTTACTCGGGTCTTTTCAGCAACCGCGATCAACGTGACGCTTATTTTTACAATTTGATGTCGTCCTTTGCAGC
AGATAGGGCTCGGGATCGAATCAGGTTGTGTTGGGTCGACCCGTTTTTTTACCCGGATGGTCCGGATCACAGGTCGAGCGTTTACCCAGACCATGACCCA
TGGGTCCCTGTATTTAGCTATATATACTGTTTCCTTATCAGTCAGCCAAATTCGTATTTTTATTCTTTTGAATTATGCATTGAGCTCTGTATCCCATTTC
CAGTATATTTTACTGTTTGGGGGTGTGAGAGTGGATTTGATAAGCTTTTTGCCAGCAGGTTTCTTAACTGAAATTCAATGGAGTGTTAAGAAATTCATCT
GCAACGGACTGTGAGTCGAAGTATACACAAATGTTTTGTCAGTCACCTTCGCTGAAAAAAACAGTCAGCAAGCAGTGGTTGCTTCCAGCACCAGTGGTGG
CGAAAAGACAAGATGATATTCAAAGCACTTTATGATTTAGAGAAGAGTTGTTTTCATAAATCCAGACAATTATGGTGATCAGCAATATGGGGCGAGCTAC
ATATGAGTATGCAGTGATTAGTGAGATCATAAACTTGTATAAAAATATAATGAACAGGCTTTAGGAAAATGGAAAGCAATCGTAACAAGGTGCAATGCGT
GCATTTTATATTCAAGCAGTCAAAAGGGTTCTACAAGATAAGCAAATGACGTTGGGATGTATATAATAGTTATGATATAAATTGTAGACACGTCACCAAG
TAATACAAACCACTGCGCTAATTCACGTGCGGTTTTGAGTGCATTTATAAGCAATGATATTTCATTTGATGCTTTTAATGTAATCATAGAAAAATATCTC
TCGCAAATCCATTCGTGAGTAATCTCACCCGTCGTGCTGCACGCTTGTGGGTCATTATATTTCACGCTCTTGTTGAACGATTTGAATGCAAGTTGCTACT
GCACTCAAGGTGATCAATCGCTTAAATTATTTACCTTCCTCTGGGACGTAGAAGAAGGACTATCCAATTTGCACACTTTATTGGTCACATATTATTTCCT
CATTTAGAAATGTATGCAGCTGAGTTTCGATACCAAAAAATGTGTTATACATTAAAAAATGGACCAACAGCGACACATTGGGTCACCCTGGTCCAGCTGG
TCCGGGCAACGGGTCGGGGACTGACCCGGGCCAATGGCCCTGGGTCGGAGCCCTAGTAGCGAATACCTAGTTACAGATAAACCTACCCAATTTGATATTA
TCCATAGAATGCAATTGTATTACATATAACAAGTTATCAGATGTTAGAGGTGCGAGCGCTCTCCAGTCACACTCGCAGCCCTCAAAACTAGCAATGGAGC
CCGACTTTGTGTTTAGTAGCTCATTCCAGTATTCCAGCTATAGCTCTTCCTCACTCTCCTTTGCCGCGTAACAACGATGCCGTCGAGACCGCGTCAGGTT
AGCAACCTGACTTATAAACAGAAGAAGAAGGGTTTCCAGTAGCATGACGCAAACGCCGCTCTCAAACAGTCGCATCTAGTAGAAATAGCTCAGTGCCAGC
TCTGTATCTTCAAGACGCAGAATGTCGGAGTTTCTGTTTGTGGAGGATGTCAACCTCAAGAGCAAGTGGACGCGAGCGCTTGCATTCCGTGAATTCAATC
AGGTCCTTGCGAATTTTAAGCCAATCGCGTGATGTGGAGAGGTGATAAGATCAAGTCGAGAGTGATGCTGTTTGCCATATTGATCCGAATCGAGGACGAC
CAGCTACTGTCACTTTTAAGCGGGTGGCTACAGGAGTTCCAAGGACGCCACGGCTTCAAGCAACTTAGCAGCCACGGTCAGAGCGCCTTCGTAAGCTCGA
TGGGGATGTGCAACCCGAAGCCATCCGGGAGCGCTAGAAATATATGGCATCGGCAAAAAGAGACTGCTTTACTGCCTCGCACCCCATAGGGCTATAGCCC
AACGAAAATTAAATGGATTATCAAGAATCGTGTGACGGTCGCTCTGATGTACAACGCTGACGGTTCGTAAAAACGTGAGCAGTTCATTGTTGGTCACGCA
AATAATTCGCGCTGTTACAGAAGAGGACAGAAAGTCAATTTGGCTTCTAATATCGCAGCAGCCTCAAGGCGTGGATGACTGATTTCCTGTTCCGATAGTG
GTTAGAAGAGCTTTATAACGATATGTGCATTCAAAAATGCACCACTGTTCTCCTCCTCGACAATTCATCGTCGCTAACAGCTCATAACATGAAGCTGAAG
AGAGTGACAGTAGTGACCTTCCGTCAAACACTACTTCAAAGATCCATCTTGTTGATGATGGTATTATTGCCTTGTTCGGGCGTCAATACCGGCACATCCG
GTTCGAGCACGCTTTGGATATGGAGAAACAAGGATCGCGGACCAGCATCTACAATGCTGGCTCAGCTCACGTCGATGTGGATCAAATCCTTCTGGCTTGA
ATTTAGGGCGATACTATTCAGTACTGCTCTCGGCACACATGGAACCTTTTTGGTAGTACAACCACTAGCAGATCATGCATAGACGCCGTAATTAAGCTAT
CACCATCCTGCTGGCACAAATGCTTCAGCTCATGGACCTGAACAATTTCATTTGCTTCACTGTCGAGTCTGAAACTAATATGGAAGCGCTGAATGCCACA
GCCCTTCCCAGCGAGGTTTTGAGCACTGGTTTTTGTATACGCCTCAATGTAGCACCGACATTACGAAGTCACAGTTCAGAAGCGAAGGCGTCATCAACGC
GCAGACAGAGGTCAGCACCGAGGGATAAATAGACGTAGTTTGATCCATCATTTTTTCTCTAGGTGAATATCCAGTTCTAGATCGGCTTGTCATGGGAGGG
ATGCGTACAGTACAGTAGGATTGCGGAGATGAGGGTAGAAAAGTAAAACGTAATCACATACATACGCTGATTCGTAAATACTTTTCTGCGTCATCAGCCG
TGCAATATTGACGACACGATAATGAAGCGATCTTGATAGCACGTTTAATAATTTTCGTCGTTTAACGTGTTAACTCAGATTGATCACGATTTCCGCATGC
GCGATGTGCATCTATGACCGCTGACACATTCGACCCACGGTTCACAGCCTACCATATAACCTCTGACATAAGTACATCTACTTTGTACACGATCATAACA
TGTAATTGGCTCCGTTAAACGGTTCCACTTCAACACGGGGTCGACGCTTGGTCGCATAACCTAATATCAGAGAGCGCAGAACGCGGGGATCGGATTTCTG
GTTAAACCACTACATCCAGATGCAAACCGTTTTATGTGTCTAAGATTTCTAACAATTCTTATGCTTTCCCAGGATAGTGTCCTTTCAGGTCCCATCGTTT
GTCATAGTCGCACTCCCTTTCCATCTGATGTGACTCTTTTTCTCATTTTATCTGATGGGGTCCATCATTAAAATCGGGGATGTCACTGGCTGACATACAG
TGCTGGCATGTTCCGGAGCCCCACGCATCAGGATCCGACGGTGTAAATATATCACATTTGAGTTTCTGGTAACCGACCCAATGATTAATGGGATGATACT
GCCACAGCAACCCTTTCAAGCCAATAAGCGTAATTAAAATGAGGAGTATTATGTCATAATTGTATGTACCTACGTGGAAAATACACTCGCACATCTGTGT
AGCCGCACCACCTAAAGCCAATTGAACGTACCCAAATATATAGCTATCAAACCATTTCCAACAATGATATATTTGTGAACCGCACGAGGGCGGAAATCAA
AGCCTTTTAAGTTTTCGGGGGGGGGTAATTGTTCACGCCACTTATTAAAACAACAATCCAGGAAATATCAAATTCTTACAAGCTTATTGATCTATCGTCA
CTTTTGCCTATTACCAACTATACGCAATACATTAAAATAAAAACGGAATAGGTGAATCAACAAGTAAATCGCAATACCAGCACCAACCAAATGCAAACAT
TGCAAAACCCGCACCAGTAGCAAAACCAGCACAACTGCAGGACGGAATTAATGTGTACCACGCTAAACCCAACCAAATCTTTATCATGATAATATCTCAA
TATTAGCAGTAGGCAAACAAAATAGTCCGCTCCCCCCGCCCCTTCTCATGGGCACCCACCTTCGGCGGAGATCGTCTCTTCCTCGACCCCGAACTTTATG
AGGGATGTCTCGGTCAGGCTTCTTGTGCGGTCGCAGGATATGAGAAAAGGAGGCCGGGAGGGGGAGAAACACAAAAAATGACGTTAGGCCATCAATCTGT
TGTCTAAGTTGGATTTTTACGTTGAAACATGCAACATGTAACAGTGCGGCATTCGTGAATAATCATACCTCATAATCAGGAGCTACTCAATCCAAACTTA
TTAAAGCCGAATGTACCGCAATTATGAGATCTAACTGATGTGCTAAGCTATCGTTACTGTTCTTACATTATTCGATAGACGTGTGTGTGAAACAAGAATG
TTGTGTGTATTCGTGTATATACTCATGTCAACTACTTTTTCTTTGTATCATGAGTACATGATCCACGGCTGGCCACGTGCCTCGCCACAATGGGACGCTT
CGACGGTCGTGTGAGCGCGTTTGACGGGCCGTAGAATATGTGAATGGTACCACACATCACGGCCGGCGTCGTTGCTGCAGCGACCGTGCGCTCAAGAACA
GTAAGTGTCTTGCATGTTCCGTAAACACCAATTCATGGAGACAAAGGCAGTGCTATTGTACAGCAGCATAGCATGACCATTTTTCCGTTGCCGCCGACGT
AATTAGCATTGTATAATCACCAGATATATAGAGCACCGGATTTTTTATCTAGGCTTAGACAACAACAGATATCGGTCAGCGTTTGCATGTTCAACAGACA
CGGAATACTATTTCTACAAAGTTTTAACCATCATGTTTATTGATGTGATGTCGCGATGAGCTATGGACTGCAGCTTTAGATTAGTAATACGGAAATTTAT
CCTCGCTTGCAGACTTCGTTCGGAATGATGTCGGGCACGGCGGTCCCTGTCGTGACAAATGGCAGCACCATCGATGAATCATACACATTCCTCAGGTGAA
ATATTTTTTGCAGCGACTTTTTCGTTGTAATGGACAGCACCAGTTTAGCGGCACCATGAACCCGCCTAAGTCGAGTGCTGCCATTTCGTCGGACATCTTG
ATGCAATGATATTATTTATTCTTTGTCAGTTCTACTCTTGGCACCTGGAGACTTAGTTTAATCAGTCATCCATAGAATAGCGTGGTACACATTAATTCTA
TCACGAAGTGGTGCTGGATATGCGACTTGTGCAGATTTTGCCGTGTTGCATTTGGTTGGTGCTGGTTTTGCGATTGACTCTGGATCAACACCGTATCAGA
TATAACAAGATATCATGTGGAATCAGATCAGCCAGGTTTATCTGTCCATACCTTGAAATCTCCGACCTCCGACGCGCTCCGACCGGGATAAAGACAGTAC
TAAATTGTGTAATTGTGTGTTAATTATTATAAGTGGATGGGGGGGCTTAAAATATGATAAATTGCGACAAATTGATTGTACTCGATTGACTCAGGTGCCT
TGCACGACATGTTCATGTGTTCGTGCTCGAATCTGGTATCTACGTGGTGATCTGCTTCACTTCATCGGGAGTAGTGCCAACGTGTTGATCTACTACGACA
TGCGGACTGTGGACGAGCTATACATGAAAGTGCTTCAATGTATACGTACGTGCACAAGTGTCCATGTATATCCACACGCACGAAGATTGACTGCGAATGG
ATCGTTATGTTGTATTCAATGAAAGGTTTGTAAACAGCTACGTGTTGGACAACCTGTCGCCCAGGTGATGTCCGGACGACCTGTTCACCTGTGCTTAAGT
GGTGTACAACACGTTTGCTGCGTACGTGCACATGTGTTCATGTCTATTCACACGCACGAAGCTTGACTGCAAATTGATCGTTATGTTGTATTCGATGATA
GGTACATGGTGGACTACCTGCCGCCCAAATGCTATCCGGACGACCTGTTTTCCCGTGCGTAAATGGTGTACAGCGCATTTGCTGGGTACGACAACGCGCT
GGGCATCAGTGTTGGTAACGAGAACAACCTGCAGATAGAGAATGGTGCCGATGGCACTGCGACGGCACCATGTGTCAAGTATCTTTACGTGACACACGTA
GTTACGCTACGAACTGCTCGGGGTCCATGTGTCAGGTGCCCATCGGTCTCGACATTCCGCCTCGCGAGCAGTGGATGGTGTAATACGATTTCTTAGTCGA
TGACGATGAGAATACGCGTGCTTTAGGTATGACGAGTTAATAGTTGATGGAGACTTTTCAGTGGATGCTGTGACTGAAGTGGATGTAGTGGGTAGATAGG
TGGATGGGTGGGAGATTGATCACTATGTGTAACAATCTTTTTGTGGCTGCTTGAACAGGATGGGCTTCAACCCGTACGTCAAGTGCGATCAAACGACCGA
CGTCAAGTACTCGCATCCTTCCAGGCTGAAGAAGCTCATGTCGGTGTACGCGAAAGTCGGCTATTCTCTTCCGATCATGTGTGGAGAGTTTGTTTGCGAC
AAGTGCGTGAAAAATATTGACTGCTCGGGAACCAGCGTATGTTCTACAATGTAAGGAGCGAGAAGAGGGAAAGTGTAAAATGTAGTGAAGATAACAAAGT
TGACAAAGATCCTGTTTCGTGTGTGTAGTCCAAGTGAATGAACGATGAGAAGGGGTGACCTACGAGATCGTGGGTGGCAACGTGTTTAAGTAGACCACCG
AAGTCGCCAACCTCGTTGAAACCAAGAGTAAGCTTATAAAGCGGTGAATGTGCATGTGGTCGGTTGGAAGAACACTAATCATTGATGATTGATGCGTGCT
TGTAGCTTTGGCCAACACTGGAGTCGCAAGCAAGAACGTCGTCGGATACTTCCAGCCGGAATACAGCGACAATACAAGACCCGGTACAGGTTCAATCCGT
ACATGAGGTATGAGTACCGGAATAAATTGTAACCGATGAAGGTGGGCTCGACGTCTAGCATAAAAGCTGCACGCCGACACGTGATACGATTCTGTCATGT
CCCAAGAACATTTTGAGCGAGCTGACCCAGCCGCACAAGGGTGAAATGGATTATTATACTATACTGTATATACGCCGCATCATGAGAGTCCGGATGAGCT
AACGAGTCTCGCCAATCTTGTTCATATGTGCTTGTTCTAGTCCCCATTCCTTAGTATGCGATCCTGCAGCCGGTATACAATGGCGTGAAGACCAACATCT
ACATGTACTGCGGGGTGGTTATTGATCCAATGATGTTTGTAGTATGCGCAAGTGCTGGATCTACAATGCTCCCGGTGGCTTGAAGTTGTCGGTATCGTTG
GATGTGTTTGTTAAGATGAACATCTTTGTGCAGCTTGCGCATGGCCTTGAGGACATTTTGTGCTCCGTGGGATTTGATGTAGTGCTTGCCAAGAAACGAA
AGTAACCACATCTAGCGACATCGCCAAACTCCAACACATCGTCTCGATACTGCGGATACTTCTCGTCAAGCACGAATCCATTAGCGAGAAACAGCTTCAT
AAATACAGCGACAAGTTTGGAGGTAGATTTCTTGTGCTTGCTGGAGCAATCGAACGAATCCTAGAGGCGGGGTTCCTGGGTATATCAGGAGAACCATACG
TCCTTTAGGTTTGTCGATGAACTCGTTCGGCGACGTTTGGCTGGTGGTTCTTTGCTTTTATCCTCACTTCTCTCTTGTCTAGTTTTTGGCTGTGCTTTGT
TGTAGACCTCAGCTTCCATCATCGAGACGCGAGAGTCGAACCTTTGGGTGACCTTTATTAACTGTTTAATCAATGAAGCTTGATGAAAAAATGTTGGGTG
CTTTTGATGTCGATGGTGCTGTCTTGAGCCTTGATGAGATTTGGTTGCATACTTGTCTTTGTGTAGCAGTTTCGATGCGATGACCAATCTAGAAGATCGC
TGACGGAGTGAACTTGCTGGATGAAGCACGCTTCCAAACGTGTGACTACAAGTCAGTATTTCTTGAGCTGCTTCAATGATGGATAATGAATCAGCAGGTA
AATGATAAGCGTTTCAGTAACCCTTTTGTTCACGTTGTACTATGTAGTCGTGAGCCCGTGAGACGCATTGAAGAGCGCTGTCGCAACAGCTTTGATCTTT
GTCTGCGTACCGAAATCGAAGACGTCAAGTGATAGAAAAGATGCGTCGGTATCGAGGTGTCGCCCACTCAAGACCCGAGCAACCTTGTGGTCTTTGGACG
CTGTATTAAAAACGTATGCGAAGGCCTTATTCGTCGCTGTCATATTCCACGCCCCTCGGTCGAAGATACACTGTACACACAAGCCAGCCCCATTTACATG
CTGCTCTTCTCTGCGCCGAAAAGGGTGAGATGTCAAGCGCTCGGATACGCCATCTTTTGCCGCGACCCGATCAAGAACACGGTTAATGTAGCTGTGCACA
CCAGCAGCGGTGTCTGGGCTGTTCTTGTTCTTAGCAGTGGTGGACGATGTATCCGGTGAAGACACCACAACCTCTGGGTGACCGAGCACATCGATGAGCG
GAGTTGCTGGAGCTGACGAGGACTGTGAAATACACGTCTGCTCAGGAAGTTGACTCAGCACAGATATAGCTGGCGATGAGTGGGTCACGAGGGCGAGCGC
TATCGCAAGCAGAGGACATGTGGTGAAGTCTTCGTCCGGATAGAGCGATAGACCTTGCTCTTCAGAAGTCTTGATGCGGATGAAACGGACGAAGAATATG
TCGCCCAATCCGATAGACAGGTTAGCCTTCCGCAGCATTGTGAGGTCTGATGTGCACCTGAAGAGGAACTAAAGCAGACACAACAGTGCCGCATCTTGGT
AGTCAGCACTAGTAACCGCAGTTGAATACAAG