Description :
From Genome Similarity Track
Location :
Scaffold_1845:2270- 3551
Sequence
1281 bases(100 bases per row)
TATTGCCAAGGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGTTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCATCATTAATAAGGCAT
GACCGCGACCCACGCTTCATGAGCGAGGTGTTCCAAAGCGTTCGCAGAGATGATGCAGTCAAGATCAAGAGCGACTTTGAGCTATCGGCCACAGGCTAAT
GGACAGCAGGAACGCTCGGTGAAGTCAGTGATGGGGTCCGTACGGGTGTACGCGGAAGACCCTATACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAG
TATTTGCTATTAATACTTCTCAAGACACTACGAGGAAGGAAACGCCGTTCTACCTCGTTCATGGTTGGGATGCGCAGTCGACGTTGCGGGCAATGTCGTC
ATCACTCAAACGAGGACTCGGCAAGCAGTCCGACGCACTGGCGTGGCGGCGTGAGATCAATCGACAACATGAGGTCGCCCTCACTATGGCCAAGGATTAT
CAGGCCGTAGAAAAGGAGTGAAGGGCTAAAAAGCATAATGATGCTCTGAGTCGACTGGAAAAAGCTGCTGTACCTCAACCAAGTGGAAACGAACACTCGG
CGAACCCCCCCAGAAGCTTCGGAAGAGATGGAAGATCCTGCAAGAGCCCCACCAAGATCTCTTTTTGAGATTGTGAGCCGGGCGTGGTTGTACATGGAAC
GCGTCAAACCGGGCTTGACGAAGCAATTAGCTCACCGATGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAAAGTTTGCGTACGAGCTGGAACTGCC
TGATCGAAGTGGGTATCGCTTTTACCCAGTAGTGCATGTGTCAAGACTCAAGGCTGTCAACTAATTCAACAGTCGACCGAACACTCGGTTGGTACTTGAC
GCGACTAATGTAGCAAGACTCGACTTCGATGAGGAACTACTGCCTGAGGACAGCTGGGAACCATATCAAGTTGCCGGTGAATATGAAGTCGAGGCCATCC
TCGACGACAGAACACCACTAACGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAAGTCAAGTGGGTGGGCTATGAAGATACAACTTGGGAACCATCATC
AAACTTGTCATGTGGAGGTCTGCTGTACGACTATTTGCGAGCCAAGAAGAGCGAGAATCGGCTGCAGATGGCGCAAGTGGCGGACGAAGACTAGCGTGAC
TTGATCACGTATGAACTGTCCACAGGGCGATGCAGCCTGTGGTAACAGACGAAGAACGTTACTGCAACAACAAATTGTATA