Description :
From Genome Similarity Track
Location :
Scaffold_2364:227- 2297
Transcript NameFunction/comments
Phyag_g12392conserved hypothetical protein

Sequence
2070 bases(100 bases per row)
CAGTTCCGCATCTTCCGTCTACTGCAGCGACCATTGCCATGACCAACGCTTTGCACATGTATCCGTCCttggcattgctgctgtgggtctGGGTCACTGG
TGTCCTGCTGCAAGTCATCGGGTTGCTGGGTTGGTGGACCTATCGCCACGAAAGAGCTGCCCGATCCCATCGTGGACGTCGCTACAGGCCAATAAACCAA
GACGACGCAATCGACTGCACGGCGACTGCTAGAGATCGCAGGACGTCCGACAACGTGCCGGAACTTAGCACGCGAAAACGTTCATCATCGACAGTGGACA
GtttggagaaggacatcGAAGCATCGAAGATCAACCCAAAGCCCAAACTGGCACGcacaggagcagaagaagacgaaggcgatgacgGGAGTGACGTCCA
CAATTTCAAGTGGCTTCAACTTTCATGTCGCTCAGCGATTGTTACGCTTTTCATTGCACTAGCTTGTGTCATTACCACTACGATCGTGCTCAAGTTGCGG
ACTGGGTCCTATTTGGAACAAGAATACGACTGGTACTCGCTGGAGAACACTGGGAAGCGGTTGTACCAAAATTCGCACCGGTTGCCTGTTGGTATCATGG
GCACCTGTAAGTTTCGTGACGCTATGGCCGACTACACCAACTTTCGGACGTTGGACCCAGTAGTTAAACGGCACACCGAAGGGAAGAAgcaacgaggagg
agaagcagatccGCGAACTGTTGTATATGTTGTTCCCTTTGACTACAATCACGTACTCGAGCTGAACCTGGATCAAATGATCCCTATTGTGGAGCCGCTG
CCCCAGTATTGGACGGCTTCGAGCTCGTCTGGTGATGGCGACAGAgatgttgctgctattgTAACGTCGGGCTTCGTCAAGGCACGCCCAGTGGACGAGA
TCACATTGTTCCCGTATTTGTGGCATAGCCTCCTCGGTCCCTACTTCGACCCGCGTGTAAAAACTCCTGCGGGTGACCCGTGGACGTGCACAGTAGATGC
GCTGAGTCTGGAGTTTCGCGTGATCCAcaacgcgctggagctgcgcaaccTGCCTGCTAAAAGCAatcttcttgttgcagcaCAGTCACTCGACTGTATC
AACCGCTTCTTTGAAGATGACGGACTTCCACCTGATCCTCGTGTGGGATTTCTCACGCTGGCGAACGAGGACTGCAACAATCCCAATCCCGAGCGCTTTT
TGGATAATAATGCCGTCAAGTTTGGCTTACTCCCGTACGGAGACTGCACACTCGTGGATGGTAAACGATTCGCGTCATTGCCATTAGGACCGAGCTTCGA
GCATGGCTTTCCTCTGAACGCGCACCACCTCAACCCTCCACTGCCGCCGCTTACTACTGGAGTCGGGCGTACATTCCTGCTCAACCTCATGGTAAGCTGG
ACTATTGAGAAGCCGACGCGAGTGCAAGCCATGATGGCAGCGTTGGAAGTGTGCGGCGACCTCGAACGTACAACACGAGCCAATTCTCGACGATGCGTTG
TCGAACACAACGACATGCTGTTCAAAGTTCTGCAAGCTGTGGACAAGCGAATGGGTACTGCTTGGCGCTGGTATCTGTCGGCCGCACCTGCTGTCTATAT
GTCCACGTTACAGCAGTCGGTGTTCACAATCTGTCCGTTAGGCAAGAACCCGGAGCAATACAGGATCTGGGAGGCGCTATCTTCTGGATCGATCCCTATC
GTGGAAGAGCTACCAGAGCAGTGCCAACCTCCTGGTGTGTTTTACCACCCCGCGTACCCTGATTCATGGCGCTGTGTTCCTGAAGACGTCCATGGCGTGC
TTCGTCGTCTAAATGCACCAGTGCTCTTCGTGAGAGACTGGAAGCGAGACCTCCCACGTTTGATGAGCCAATACTTCACCAGGTCAAGCAAGAACGGAGA
CTCGATCTCAGCAGACTTCAGGCAGAGTGAACAAGACACGAGCGAGTGGGGTGAATGGACCCCGACCGAAGAGCTACTAGCGTTGCAAGCACGCACTCGT
TCATGGTACGTTGGCCTCGGTCACCATTTGCAGTCAGGCCTCATCGACAAGGTCATGACGCATTTTGCAG