Description :
From Genome Similarity Track
Location :
Scaffold_2616:227- 1550
Sequence
1323 bases(100 bases per row)
AGAGAAAGCGGTTGTGGATGCTGGTGATGCACGTCGTGGACGCTGTTGTGCAGCGCCGACCACGTACAGGAGGCGATTGTGGTGAAGTGCTTTCTCAGAA
ATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCAAGTTGCCT
GTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGG
ATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGCGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTG
ACGGTGGATCTAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGGTCCCATACTTCTGAGTTCGTATCCAAGGAGGGAGGATCCC
GCCTGGAGGGACCTGGATCCAGGGTATAGGGATGAGGGATACAGTGGATCTCGAACTTTCGTGGGACAACGGAGATCACAGACGGTTGCGAGATGATGTT
GGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCA
TGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTA
GCAGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGTCCTCAATTTGCACAGTATCACGCAAGTGCCTTCCTGCCC
TCAAGAACCGGAATTTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATC
CTACAACCTAGTGAGCTTTTCCTTTACTCGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGTTCTCAACTCTCAAGA
TCCCGTCACAGGAGGCGGCAAGTACGACGCAAAAGAAAACGCAAAGGCAAGGGACACACCCGCAAGGCAACCCCACGGCCAGATCCACGATCTAGGCCCC
GGATCCATAAGCTCGAATATTCGCTAAGGATTCGGAACAATCCACGGACGCAGAGTGAAGCTTTTTCACTGCTGCTCCACCCCATCCCCACGTCTCGCCA
AGACACTCAAGCTTCACCACTTG