Description :
From Genome Similarity Track
Location :
Scaffold_3649:227- 1468
Transcript NameFunction/comments
Phypl_g15955reverse transcriptase

Sequence
1241 bases(100 bases per row)
gacgaagatgactGCGCCTTCTGCGTGGCGTCAGGGCTGAACCTGACAATCTCGTCCGCGGGATTGTCACTACGCGACGAGATATCTTCCGCGTACGCGC
ACGACGCGGTGTACGCCAGCATCCTGGCGCATCTGCGCGCGCCGAGCGAGAAACACTCGGAGCCCTGACGCGCTCTTCGCGCAGTCACATCGAGCGATAT
GACCCCGATGATGATTTGCTGACCTACGCCATCGACCTGTTCGATGCCCCGCGAGTGGTGGTGCCGAACGATGGCGACCTGCGCGCCCGGATCATTCACG
AGTACCACGACGCACCCGCAGGCGGCCACTTCGGCCGCGAAAAGACTTTCGCGGCGGCATCAcgcgacttcttctggcCCCACCTGTACAAGTGGATGCG
CAAGTGGGTGCGCACTTGCGAGACGTGTCAGCGCGTGAAACCCTCTGCGTCTTCGCAGTCCCCCCTGCGTCCCCTTCCGGTCGCCACGGAAGCCTGGCGC
TCGGTATCGATGGACTTCATTTTTGGGCTTCCGCCCGATTCCGCCGGGCGCACAAGCGTTCTTGTGTTCGTCGACAGATTCAGTAAGATGGTACACCTCG
TACCTGTGCCCACTTCGGCCACCGCGGAAGAGATCACGGTGCATTtcgtcgacgccgtcttcCGCCACCACGGCCTGCCGGACTCAATCGTCTCTGATCG
CGATCCGCGGTTCACGTCCGCGTTCTGGTCCAAGCTGTTTGAACTGCTCGGCACGAAGCTCCTGAtgtcgacggcggcgcatCCGGAGGCGGATGGACAA
ACGGAACGTGTCAACCGCGTCCTCGAGGACGTGCTTCGCAGTTACGCGACGTCGttcacgagctggagctcattCCTGCCCCTCGCGGAGTTTGCCTTGA
ACAACGCCGATCACGGGAATGACTCCATTCTTCGTGAACTCCGCGCGACATCCGCGCGTTCCTGCGATGCTTGCTGTGGGCCACCCCACGGCACCCCGTG
CCTTCACCCTTGGTGGGGGAGGAGTCGAGACTTCAAGCGAATCGCCGGCCAAGATACCGGCGAAGGACACGTCGGCTACCCCTCCGGCGACACCACTGCC
AGCTTAGCGTGAGGCCACCGTCAATGCCGTGACACGGGCTCAAGCGATGAAGATCCTGGCAACGCCGCGTGGTGCGGCGACTCCGCTTGCAGAATGGACG
AAACGGACACTGGTCACGCCCAGTGGCGACAGCACCGCACG