Description :
From Genome Similarity Track
Location :
Scaffold_4150:227- 1376
Sequence
1149 bases(100 bases per row)
GGGGCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTATTCTTCTTGAAGAGCCACTTGA
ATCGCCTCTTCAAGGGTGCTTGCCTGCACCCGGGAACAGCTGAGTGCGTGCGGGCCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCA
TTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGTCTTCCTTGTTTACACGCGAGGAAGCGCGAAC
GCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTCGCTTCCCGAGT
GTACACCCAACTCTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACT
TCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTTACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGGTTTGCTCCCGCCGCCG
GAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAG
GCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACG
AACTTCGGAGGTTCAGGTAGTCTACCCGCGATGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTT
ATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACTGGTCCCCTCTTTAATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTG
AGTATATTTATAGGTAGGTTAAGTTTGAGGTTAATACAAACTATCAGTTACCTATAGAAATGCAATGTCATTTAACCAATGCTTGGTTTTGAATGACCTT
GGTACCTTGTACCAAATATCCCGGAGTATGACATGTCATACTCCTGAAG