Description :
From Genome Similarity Track
Location :
contig_2:226841- 228675
Transcript NameFunction/comments
g484.t1hypothetical protein PHYSODRAFT_492233

Sequence
1834 bases(100 bases per row)
CGCAGGAGAGGCTAGTGAAGAGGAAGTGCGGGTACTCATGTGGTTCCGACGAGACCTGCGTGTGCATGACAACTTGGCGCTCGCTGCGGCGCTGCAGCTG
GTGAGAGAACAGGAGGAGAAGATGATGCAGTCGTTGGGACACAAGGTGGTGTTCATCCCGCTGTACATCGTGCACCGCCCCAAGATCATGCTCTGCGGCG
TCAACCGCTTCCAGTTCATGCTCGAGAGCGTGTCGGACTTGGCTGACGCGTTGGCGGCGCGAGGCTCGCGGCTCGTGGTGGCCAGAGGAGACGGAGTCCA
AGTGCTGCGGCGCTTGCTGCCGGCGTGGCGTATCACGCACTTGTTCTTCGACGCGGCCAGTGAACCGTTCGCTATTGAGCGAGACAACCGTGCAGTGGCG
TTGGCCAGCAGATTGGGGGTTCAGACGCACGTGACTCATGGATATACACTGTACGACTTGGACGCAGTGATCGCTACGAATGAAGGAGAACCGCCAAAAA
CCTACACAGCGTTTCTGCGCGCGTTGGCCATGCAGCCGAAGCCACCCAAGCCACTCCCTACGCCGGAGAAGCTGCCGACCCCCACGTGGATGCCCAGCGA
GTTATATCAACAAGTTGTGGACTACTGGAAAGTCCGATTGAAACCTGAGAGGGTGGTGAAGCAGCCTGATGTGAAGGATGAGAAAAAGGAGGAGGAAGAG
GAAGACCAGGAAGAAGCAGATGACGACCCGGAAGAGAAGGCCAAGCAGCTTGACGAAATCGCAGGCCCAGAGCAGCAGTTTACGCTTCCGGAAGTGAATG
ACTTTGGCTATGACGCTCCTGAGCGACACCCTTTTATCTACGGCGGGGAGCAAATTGCGCTGAGCATTTTGCGTGATTACTGCCGCAATGAAGGCCGCGT
GGTCAAGTTCGAAAAGCCCAAGACGTCTCCAGCTCAGACAGCCCCATCCGCCTCGACAACCTCGTTGAGTCCGTTCTTGTATTTCGGTTGTATCAGCCCA
CGAACGTTCCTGCATCACGTGCGAGCTATTCAGGAGCACCACGCAACAGCATTGTCAGCTACACCCGTAAGCTTGGACGGACAGATTCTCTGGCGTGAAT
TTTTCCACTGTCATGGCCGGGCTAATCCGTACTTTGACAAGATGGAGGAAAGTCCTACGTGCCTGCAGATCGACTGGCGGTGGCACACGATTCCGGAAAA
GGAGGAGGAGCTGACCGACGACGACAAGCTTGCTCGCTCGCAGTTTGATGCTTGGAAAGACGGCCAGACTGGTTTCCCGTGGATCGACGCCATCATGATC
CAGCTGAAGGAGGAAGGCTGGATGCATCACTTGGCGCGTCATTCGGTAGCATGCTTCCTTACTCGCGGAGATTTGTATATCTCATGGGTGCGTGGGCTCG
AGGTCTTCCAGGAGCAGCTTATCGATCACGACTGGAGCATCAACGCCGGTAATTGGCTCTGGCTCAGCAGTAGCTATTTTTTCTCGGCCTACTTCCGCGT
GTACTCTCCGTCTACCTTCGGCAAGAAGTGGGACCCCGAAGGCCTCTTCATTCGCAAGTATGTGCCAGCATTAAGTAAAATGCCGGTCAAGTACATCTAT
GAGCCGTGGAAGGCGCCAATGACCGTACAACATGCGGCGGGCTGCCTCATCGGCAAAGACTATCCGTTCCCGATCGTAGACCATAAGATCGCTATGCGTC
GGTGCATGGTCGGCATGAAGAAGTCCTATGCGATCAATCAGTATGGAACACCACCGGTCCCTAAGCCACCTGTGAGCCCCCGCAGCAAGCGTCAGCGTGA
GCACTCGGCGAGCTCGTCGGAGACGTCAGAAGAC