Description :
From Genome Similarity Track
Location :
Scaffold_137:226834- 229000
Transcript NameFunction/comments
Phyin_T30-4PITG_20028Phosphatidylinositol 4-phosphate 5-kinase (PIPK-D12/GPCR-PIPK)

Sequence
2166 bases(100 bases per row)
CAGTTGTACCTGCTTGTAGGGATTCTGGGGTTCGTTGTTTATCTTCTGCTGGTGTTGTCCTACTTCCTCGTGCCCAACATCAAGGCGCAGCATCCGGCCG
CCGACCTCGTGGTGTGGCACGCGGGATGCGGGCTCGTTTTGTCCGCCGGTTTCGTCTTCGCCTTTGCGCTGCAGCGGCAGGACGTGGAGCCCGAGGACGA
TGAGCTAATTCGTCGGCAGTGCTCAATACTGGGCCCTTTCAATCAGTTTTTCCTACTGGCGGGCGTCTGCTGGTACCTCATGCTTTCGCTCGACCTGCTC
GTGGCGCTGGTAAACCCTTGGATGGGCTACAGCTGCAAGTCGTGGGCGTACCACACCATGCACGTATTTCTTGTAAAGTCTAAAATAACTTTTATTGATG
TGCTGACTGCGGTCTGTTTGCTACGTTAGTGTGTGGAGCGCGAGCACCGTATCCGCCTTACTACTGCGCCAGCTCAATCTCTTTGGCCTGTCGTCGCTCA
ACGTCTGCTGGATCAAGCGCACCAACGACCCGGTGCAGGTGAATACAGTCAACTGGGTTTTTCTCTTCGTCATTGTGGGCGCCACCTGCGTGCTGTCGTT
TGCGGTACTGGTGTTCGCAAGCTTCCGCTTCGTCAGACGCCAACTGGATGTCACATATCGCGCCAAGCGCCGCAACTTGATGCAGTATTACCGGTATTTA
CTGATATTTGCGGGTCATTGGGCGGCGTGTGCCGCGCTGTATTACGCAGCGTATCTTCAAGAATTTGACGGCAAGATGGCGAAACACTTCGAGCTCGCGT
TCGCTCTGGTGTTTGGATCTTACCCTGTGATGCTTCTCATTGTGTGGATTCTAAACACGGAATTATACCAGAATTTCTCCAGCGAGAACAACCTCTCGAA
ATCCGAACGAGGAGCTGGAGACTCGACCAGTACAGAGCACTTTAGCGCTGCCTTACGCAAAGATCTGATGCGCTACACGACTGCAGGGATCCGTTGCAGC
ATTTGTGAGTCCCCTGCAGACAGCTTACGTTCACCACTACTGAGTCTGGCGCGAGATCGCTTCGGTTCACTTGATCGCACTGCGGCATTATCATTTCTGC
AAATGGAAGAGGGTGATTCCGCTGGCCTCTACCACGAGAAGAAGCGCTTGGCAACTACGGTGTACAATGGCGAGTATCGGTATTACGAGAAGCTGGGCTT
CACTGACTATGCGCCCAAAGTGTTCCAGAACATCCGCGAGATCTGTGGAATCGACAACGAAATGTACGAGCAGTCGTTCGCCGATACTTTACTGGAGCGT
GCGTCAGAGGGTAAATCTGGGATGCTGTTTTACTTCACAAGTGACCGGAGGTATCTGGTCAAAACAATGACGAAGAAAGAGCACTCGTTCCTGCTTGAGG
TGCTCCCACTGTTCCACCAGTACATTTTGAAGCAGCCGAACTCGCTCTTGTGTCGCTTCCTGGGCTGCCACTCGATGCAACTTCCCGTAGGCTGGAACAA
GATGTTTTTCGTTGTAATGGAGAATATCTTTCCGGATGGTCCCGTCGATGAGCGCTATGACCTTAAGGGTATCTTCCACCAGTCGAACTTCAGATACCAA
GAAGGCATCCCTACGCCAGTATCAAGCGATTGGAGTCGCAGTGGTAGGGAAGAAGAAAGGATGGTTCTGGAGGAAGTTGAAGGAATGTTGAGTGAGAGCC
AAAGTGTGGACAGTGAACTGGGACAGGTTACAGAGAAGCAGCCGCTACTGCGTCGTGGGAGCTCGCGTCCTTCACTCAAATACGACAACGACTTTGTAAT
TCGGCGTGCTTCACTTTGTGTGAATCCAACGACCCGCGCAAATCTGCTCGCGCAGGTAACAAGTGACTGTGGATTCCTTCAGGAATTAGGAATTATGGAC
TACAGCTGCCTGCTCGGTATCCGGCATTACAACCGTCGCATTGAACCCGACATCATGGACAATCTGGCGCACAACGCGATTGTATCGGCAGATCAGTCCA
CCGTCTACTACCTTGGCTTTGCTGACATCTTGCAACACTACAATATTGGATGGAAAATCCAGCACTGCTTGCTGGCGGCTGTAGTTGACAAGCGACAAAT
CACTGCACTTCCACCCGCTGAGTATGCGCTGCGCTTTTTGAACTTCATCCACGAGTATCTACTGCG