Description :
From Genome Similarity Track
Location :
contig_55:226834- 227837
Transcript NameFunction/comments
g11486.t1RAW35142.1 hypothetical protein PC110_g8545 [Phytophthora cactorum
g11487.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
ATAGATCGTTGGGTCGGTTGGTACGGCTGGCAGTCGCAAAGTCGACGATGTGCTGGCGACGGACGTGTACAAGCTGTAGAGTATCTGGTTTCACAAGAGG
AACGTTGTCGTCTGGTGCATAGGGGACGGATAGGCCAGACATTACCGTGGGGGGGACGCCGGACCTTCGCCTGCGACAGGCTTCCAGGATTGAGTCCTGG
TGATGAAGTAGCTCCATTGGTCCTAACGCAACCGCGTTGGCGCCCTGTCCGGGTTGTAATGCGTAATTAAGGGAGTCCACCTTGATCACCGAATGGGCGT
CTGTCAGAGGCAATCGAGTCGGCCCTTCGGGGCTCACGATATGCAGGATATCGGTCGTTTCGGATGCTGTGTAGCCCGAAACGACCCCGTACGACCATGC
ATCGACGCCAGCTGGTGATGTGTGTACGAAGGCGACCGTGTGGGCTATGTATGACCCTGGCCAAAGTCTGCGTTCAGCATCTGAGACCATGCGACGCATT
ATGGTGTCCTTTGGCACTTGAAACGTGACTAGCCGAGCGCCGCCCGCGTTGCGGGCGGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAG
CTCGCTTCACTACTGTTTTTGCTATGACAGGCTTATGTTTTATATCAGTATATTTTACAGTAGACTTGTATCAAAACCCTAAGCCCGCTACGGCTCGCAA
GCTTCGCCTCCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTACTCGCTGCGCTCG
TCTCACGTGGTTCCCGTGTGTACGAACCCTAAGTCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACC
CGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTGCGCTCGCCTCCTCAGTATGTGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTAC
ACT