Description :
From Genome Similarity Track
Location :
contig_55:226804- 227830
Transcript NameFunction/comments
g11486.t1RAW35142.1 hypothetical protein PC110_g8545 [Phytophthora cactorum
g11487.t1hypothetical protein

Sequence
1026 bases(100 bases per row)
GAGTTTCTGTGACCGGAGCGTTGTCCGTATATAGATCGTTGGGTCGGTTGGTACGGCTGGCAGTCGCAAAGTCGACGATGTGCTGGCGACGGACGTGTAC
AAGCTGTAGAGTATCTGGTTTCACAAGAGGAACGTTGTCGTCTGGTGCATAGGGGACGGATAGGCCAGACATTACCGTGGGGGGGACGCCGGACCTTCGC
CTGCGACAGGCTTCCAGGATTGAGTCCTGGTGATGAAGTAGCTCCATTGGTCCTAACGCAACCGCGTTGGCGCCCTGTCCGGGTTGTAATGCGTAATTAA
GGGAGTCCACCTTGATCACCGAATGGGCGTCTGTCAGAGGCAATCGAGTCGGCCCTTCGGGGCTCACGATATGCAGGATATCGGTCGTTTCGGATGCTGT
GTAGCCCGAAACGACCCCGTACGACCATGCATCGACGCCAGCTGGTGATGTGTGTACGAAGGCGACCGTGTGGGCTATGTATGACCCTGGCCAAAGTCTG
CGTTCAGCATCTGAGACCATGCGACGCATTATGGTGTCCTTTGGCACTTGAAACGTGACTAGCCGAGCGCCGCCCGCGTTGCGGGCGGTGGGTGCATGGT
TGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTGTTTTTGCTATGACAGGCTTATGTTTTATATCAGTATATTTTACAGTAGACTTGTA
TCAAAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGAC
TTCAAACCGCAGGCGTACTCGCTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGTCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTA
GCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTGCGCTCGCCTCCTCAGTATGTGTCGCT
GCCTACGCCCTCTCGAACAGCTGTCG