Description :
From Genome Similarity Track
Location :
Scaffold_193:2268- 9804
Transcript NameFunction/comments
Physo_144517reverse transcriptase
Physo_144518hypothetical protein

Sequence
7536 bases(100 bases per row)
ACACTAACGCCGACAGAACAACATGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGTCGTCCGGGACGACACC
ACCCACGCAAACGCTGAAGCTCAATGTGAACAACTATGTCGGAAGAGAGGGTGAACTTCTCCTCCGTTGGCTTGTCGAACTCGACACAGCCATTGCGGCT
CGACGTATCGTCGAGCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTTTTGGCGGACGCGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTA
CGTGCTTTAGCACATACGAGAGTTTCAAGGATGAGCTCAGACGGGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGATCTGCA
GCAGGGCAAGCATAATGTCCATGCTTACGCTCAGAGAGCACGGTATTTGGTCTCGAACATCGTGACCAATCTGATCGACGAGGCGACCAAGGTCGTCACG
TTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCAAAGCTGCAATTACTCTTGTAATGCAGGAGGAGT
TTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAGCCCATGGACCTCTCGAGTGC
TGCAACTGCTGGACCCCAGCAATCGCAGAGAAACAATTTGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCAC
CAGCAGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCT
GCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCATCCTG
AACGTGAACTCGATGAGAGTAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACT
TCGAGGATTTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCATCGTAAAGACCGAGAAGCGCATGGTACGCGTGCGCTTCACGT
ATGAAGACCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATCGTATTGGGCATGCCGTGGCTTGCACGGCATGATCCGGT
CATCTATTGGTAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGACCCTGTTGCCGCTACGCACCCACCGACAGGTGCGCGC
GACTCCCCACTCGAGACAGCGCCCAACGCCGCTGTCCCGAATCATCCTGGGGGCGCGCGAGCACGCGCGCAGGAGAAGCTAGCGTCGGTGTTGCCGCCGA
CAGCTAATGAAGAAAATGTGTTGACCTCTGAGGTCGACACACGCTTTTCAGCGAATCAGGAAGAGTCTCCGTCCTCATGGGGCACGGATGGCGCAGGCGA
GTCACACGCCTCAGCCGTGGAGGCTGACACGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGATTCCGGGAGTC
AATGGCTTGGGTGGATTTGATTCGTCGGCTCCGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCCGCCAATGCTTGGCGTCGAGGTACTAAAGTCGCGA
CGGTTCCGAGAACCGGCGCTGCGAAAAGAAATTTCGCGTCGACTCCGGGAGTCGACGCACCCATTGTAACGAAGGGCTCCGCCAATAACAGGCGTCGAGG
TGAAGATGGCGTGTCGGCTCCGGGAGCCAACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGG
CTGCACGACGAAGCGCCGGGTGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTATTACAGAAGAACACCCGTCCACGGCTA
GGCCTGGACGAGGTCAAGAACCAAGCGGAGCTAGGCTCCGCAAAGCAAGAAGACGGCGCATGCGAAGGTCGCTACAAGAAATGTCTGCCGGGCAGACGGA
GGCTGAGAAGCCGGAGGTTGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCG
TCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGA
GAACGAAGAGCGAGAATGAAGAACTGAGGCAGTACTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTCTGA
AGAGCAGAGCTGGTACTCGTTGATATCGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAG
GATAAGGGCATCAAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGA
CTTCTTTGAGAGTCGCCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGC
ATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTAATCATCGATTCGATGGCCGGGAGCACTA
TCTACAGTGCTCTTGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCAATATCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATGCTCTG
GGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGC
TACATCGACGATGTGTTCGTCCACAGCCGAGCTGCGGACGGGATGAGCGACGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCATGAGCGCA
AGCACAAGCTCTATGCGTACCTGAAGAAATGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCTTGACCC
TGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAG
GACTACACGGGCATGATACGCCCGCTGTCACAGCTCCTAAAGAAGGACGCCGAGTGGATTTGGACTAGCAGGCCTTCGATTCAGTCAAGCAGGGCTTGAC
TGAGGCGCCGACCTTGGCGGTGGCCGACCTAGATCGCCCGTTCCACGTTGTGTGCGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGAT
CACGAGGGTCGTGATCGTGTGGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCTGGTGCGTGACAAGGAACTCCTTGCCATGAAGT
ACGCACTCGCGAAGTTTAGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACAT
CTCGCAACGGATGGCGAGATGGCTCTCATTCTTTGCAGAGTATAACTTCCTGGTTGAGTATAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTTTCG
CGTCGACCTGACTACGCCACGACTGATGCTGACGTCAATGCCATTGACGCCATGCGATCGATCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCG
CGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTATGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGC
ACACCGTTATCGGGTGCACGATGGGTTATTACTCTACCGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGGCTCAGG
ATCATGTATGAGTATCACGATGCACCGACTGCGGGGCGTCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGGGACTTCTACTAGACCCACCAGTATA
AATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTGCCGACTCCGTCGGA
GTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATG
GTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCTCGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCAATCGACATTG
TGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCCGAC
GGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGCGCGAGTGCCTGCCGATGGCGGAG
TTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCCAGTTTACTCGGGATGGTGG
CTCCTTCCTTGAGTGGGGGAGAATCTACGACTGCTGCGTTGCAGTCGTAGAATGCCGCTGACGCTTGCACAGTGTCAGCCGCAACTACGCGCAAGAAGAA
CAAGAAGCACGCGCCTGTGCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGAACGGGTCTGTACAGGGCACAGACACCGCGAAGACGAACGCA
GAGGCCGGGCCTACTGCTGGAAACGAGCTGAACGAGTTCAGTTCGGACGCAATTCGCTTCGTCCAGCGCAGACAAGCTGTCATTCGGTTTGTCCAAGACG
CTATTGCAGCCTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGCAGGGGCAACACAAATGAATTTAAGAAGGGTTCATTGGTTTTGTTAGCTAC
TCAAAACCTACCTAAACATGCAGTTTCCGAATTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCC
TACACGCTACATATTCCATCTAGCATGCGTCTCCATCCCACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGACC
CAAAGCGGAAGCCCCAGCGGGGGCGAACCTCTGCTCCAGCGTGTGAACGCGCTGGTCCAAGCGCACGACGCGACCTCCCACGTCGACAGAGATGTCCGAC
GCGGTCTGCGAGCCCTGAGCGACTTGAGCCCTCCGGATCGCCACTTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTAATGCTGCTCCACAGCAGCGACCC
GCTCCTTGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCGCCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACAC
GCTGGATTGTTGAGCGTATTGTGAACCATAGTACCCCGAAAACGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGA
TACATGGGAGCCGCGGGACGTTCCGGAAATGGTGAGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAG
CGCCCGAAGTCCCACGATCGTCGCGTTCCTCGCGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAATCGTCGTGTACCCGTTTAG
GTCTCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAACGTGCACTGATGGCCTTCGGGCACAGCGCACGGAATACCAGCGTCCACAGAGGACCTGTGG
AGCTGCTCCAGCCGCCCACGCGTCGAGAATGTCTCGAAGCGCTCACGGGCACGCTTAACCCGCTCGCGGTAAGCAGCCGGTTTCTTGTTGAAGTTCTCAA
CAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACGAGAAGAGGTCGTCTTGCTGGAGAAGTACCGGAGCTCGTGGAAGAGCCCGATGTAAT
AATCGCGCCTTTGATTCGTTAACGGGTCAAAGTGCTGCTCCTCCGCCACAGCATCATCGTGGATGCCGCTGCATACGCACAGTGGGATTTCATTTTGACG
CACGGTGTTGCCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTACTGAGGCAGCGCGCGGAGAGCTTGAAGTCGCCACATCA
CGTGGGGAGCTTAAAGCCACAGCAGCCGAGAGCGGAGTGTCGCTCTCGCCGCGCGAGCGCTTCGAGCTCGAAGCGTCCGAGTCGTCCCCTTCACGAAGGC
GTCTCGACCCGCATGCCGGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTGCTAGAAGATGCCTCGCCCTCTTCCATCTCCACGTCGTTGACCAC
AGAGGAACCTTCGAGGACAATCTCCGGTTGAGTTGTCCCCGCCGCAGCCTTGGCAGCAAGAGCGTCACGCTTTGTTTTGTGACGATCGTGGTACTCAGGG
ATAGAGAGAGTCTCTATCCCGGCGGAGGTCTTCCCCTCTGCTGCAGCGTCGGTCTTCTTCGGCGAGCTCATTGCGGAATGAGCTCATGTTTTCTTTCTCC
CAACGTGAAGAATTGACGAATGGTCAATTTCCTGACTGACGTGCCGTGACTCGCCGCGTCTAACCTTGAGGAGGGGGGGGGGGGGGGGTAACAGGGATAC
ACGCACAAGTGGCTACAGTCATTTGATCTAAATGTAATATTCTAAACTGGGAATCTGCCAACGGCTCGTTGGCTGAATTCCAATACTATGCATGTCGCTC
ATTGACTAAAAGATGCTGCTTTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGATCGTAAATGTATGTAGCCTTTGGTGTGTCTAC
ACCAAGGTCGAGAAAGTCTTTCGAACTTCTAACAGACGTCGTGTCGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATT
ATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGTCCGAGTATAATTAATTCTAGTTTAAACTAAGCTACGCTTCCTCACACACGTGCGCACACAT
GTGAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTAC