Description :
From Genome Similarity Track
Location :
Scaffold_180:22674- 24428
Transcript NameFunction/comments
Phypl_g4804hypothetical protein

Sequence
1754 bases(100 bases per row)
AAGAAAGCTGCGCCCAAGCAGAGCTCCCTCATGTGCGTCGGGCGCTGGTCGtgtgcagcgcgcgctcctgTGTCTGATCGCTCGCTCGTGTTGCTATTGC
CAGGTCGTTCTTCGGCGCGggggcgtcgacgccgccggccaagaagcggaaaCCCGCACAAGACGATGCGGAGAAGGTGGCCGAGTCGCCTGCCAAGCCg
gtgaagaagccgaagatGACGGAGACAGTGCAacaggaggaagagaaggacaagcaggtggaggaggagccggAGGACGTCAAgatgcaggacgacgagg
aggaagaagaggaggacgcggcgaAGAGCAAGACGAAGCGTACGTGGCTGTAGAGGAGAGAGAGTGAAGGTCAGTTTGGCTGATGTGGTTTGCTGTTGTC
TTgtttttgctgcagctggtcgccgtcgtctgcgtcaacgcgtcgtggacgaggacgacgaagacagcgacgaagatCTGCCCATGAGCacgacggacaa
gaagaaggaggaggtgatcgacatgacgacgctgatgTCGACTCCGGAGAAGGTCAAGagccccaagaagaaagcggGAAAAAAGCCCGTGATGCcggtg
aaggcggcgaaaaagagcaagaaggaggcgaaaAAGACGCCGGCTGGTCCCAAAAtcgagaaggaagaggccgacgcggacgaggaagaggagattgaag
agctcgaagagcttgaagatgccaagctgaagaaggaggccaaaacgcccgagatgaagaaggaaCATGCGTCTCCTGCTGCATCGAAGACGAGTTTCTT
CACTCCGGTATCGAATAAGAAGAATAAAGCCAAGACGACAACCCCAGCTGATGACAAGAAGGATGCAATGCCCAAGAGTAATTCAGAGGACTCGAAAGAA
ACacaggaagaggaaggcgacgagcCTCGGGTGACCCCGTACTTCGATCTGGCGCACTTGTTCGCCAAAATTGAAGAGGTCACTGGTCGTCTCGTTATCC
AAGATCTTCTGACGGCGTTTTTCCGCGACGTCATTCGCCGGTCACCTGACGATCTGCTGGCGTGCATCTACCTCTGCGTGTGTGTTGACCTGGCGCCGCC
TTTTGAGAACCTGAAGATCGGCATTGGTGATGCTATTCTGATGAAAGCCATCGGCGAGGCTACGGGCGCAAACCTCAAGTTCATCAAGGAGATGTACCAC
AAGGAGGGCGATCTCGGTAAGGTTGCGCAGAACGCGCGATCAaagcagaagacgctgtcgttTGCGTCGCTCAAACCTGCGACTTCTAAGGGTAGCGGAC
TCACCGTGCAGCATGTGTACAGCCAATTCGTCAAGATTGCCAAGATGACCGGAAAcaactcgcagcagcaaaagtgCTCCATCATCAAGGGCTTGCTGGT
GAAGTGCGAGAAGGAAAAGAAAGACAAGGGCGCACAGTCAGCCGAGGGAGCAAAGTACATCATTCGTGGACTCCAGGGTAAGCTTCGAATTGGACTGGCA
GAAAAGTCGATCCTCATGGGATTGACGTACGCGTTCATGACCGACAAGGAGtacaaggacaaggacaaACAACAAGAGGCTCTTGCCTTTGTCAAGAAGG
CCTTTGCCGAGTGCCCCAGCTACAACGCATTGGTCGCAGCCTTTTTTGAAGTCCAGAAGGAATCCCCTAGTGCTCCCTTCCTTCGCGTGAAGGACTTTGT
TAAGGTGGCTGAGAAGTGTGTGCTGACACCAGGCACACCAGTGTCTCCTATGCT