Description :
From Genome Similarity Track
Location :
Scaffold_329:22670- 27427
Transcript NameFunction/comments
Phyke_g8449hypothetical protein
Phyke_g8450hypothetical protein
Phyke_g8451serine protease family S33, putative

Sequence
4757 bases(100 bases per row)
TCGGGTAGGTGCTTGCGGAGTACTCTCCGCTCAAAGTGGGCATAGTAAATGTTGCATAGCGTTGTCGACAGCACGGAGCCCTGCGGGATACCACATCGTT
GAACGAACTCACGACCGTCCATTTGCACTACGTTCGTGAGCAAGTGTTCCTTCAGTAGACGCAGAGCTTTCACTTTCGTCAAGTAGTCGTATATGACTCC
ATCGACAAATATTgcgtttttcttcttcgatTGAGCCGCGAGCTCGTCAAAACTGACTAAAGCGCCAGACGGGTATGCAGGGCGCTCCATTTTGAAGAAA
AATGAGGACAGCGGTGCTGATGCATCACTTGCTTCAATGGAACTGACTTGGTGGCCGACCCAATGTTTACGGATAAGGTATTCATCCTCACGCATTGCCT
TTTTCAACACCTGGTAAAGTTTTCGCGGTCGAATGGTATCGAAGCAGCGCTCGATATCAACTGTCACACAGTAGGCCCTGGGCCCACCTCCAGACGCACG
TCGACGCTCAGCACATCGAGTACAAGAGGCAATATCATGAAAGAGCGGCTTCAGTCGCTTGTAGATTTCGTCCAAATTTCGGACTGATGCTCCAAGAAGC
CGCTTTGGCTGTCGATCCATCTCGAATGTCAAAACTCGGTGAACAGTTTCCATAGATCTGTTCACGGAGACCGAGGCTTGGTCCACAGGTGCGGCTAGGT
TCATCAGTGGACGAACCCCGGTTGCTTTTGGCAGTAGCCGTAACCGAGATGTAGCTAGCTGACGTTCAAGACTAACTGCTAGAGTTTGATCATTCGACGA
TTGAAGAATCCCTCCTTCCAAGTCATATAGAGCGAGAGTGCTACAGCATAGAGATACACCATTTAGCATTCTCACACCTCGAATTAAGTATGCAATACGC
ACTCTTACCTGATTACGTTCCAGACAGGCCGTTGGTAATATGCAATCTCATTTGCCATTCCTTCAGCCTCTGTGACGTAAAACACACTCCGTAGCAGCGG
GAAAACTAGATATGATATCACCCACCCCAGCAAGTCCTCGAATAATCTGTGACGCTTGTCTCTTTCGTTTGGCGGGCTGAGTGCATGGAAAACAAAGTCA
TGAATCAGCTGGGTCACTTGATGTGTTACAGCAAAAGAACAAACAACCCGCACCAGAATGCCGCATTAGCGTGGAGGTTCATCCACTCGACATTCGTAAC
CTGAAACTCATTGGCACACTGCATCGTAAAAATGCAATTAACTCATGGCATGATCCCAGCATAAATACCCCCATTTCCCCCTTAACTTAGATTGCTTACC
TTCTTTAGCGAAAAGACATCAAACTTCCGAGAAGAAATAAGCTTGCGTAGCATCGCTTTCACACATTTCCagttcttctttgtcttgcTGTCGCCCCATA
CACTTTTTGGCACAACTCTAGCAACCAGTTTACGCACAAGCCGGTTAATCTTTTTCTTAGGTGTTGTAAACGCCAGCACCCCCTTGATATCCtctttgtg
ctgctgcaactttgCCAGGCCCGCACTTTTGCAAACTCTGATGTGACCTTCGACACCACTGTTGAGTCTAttcttctgtttcttcctcGGTTGTACTGAT
TGATCCAAAGCAGTCCTTGACGGCACCACCGAGGCATGTGACAGCATTTCAATGGCTTCTTCTCTTCGCTTACGCTTTTGATCACAGCTCGGTTCCTCGG
TTTGGCTTAGATATCCATCATCCAGTGCCTTACGTACAATAGGTAGGATAAGCGGTTGTGAAGACGCCTTTGCATTAGCTTTTCGTTCTGCGATCGTGTG
CTTAATTTTGGGATTACCAGCCATAAATTCCCGAAAAGCAGGCGACAGAGGGATCAGCTTTCTTGAGAGGTCTTCGACATCGCATGCCTTGAATCGTGCA
ACTAAGGACTGCACAGTCGGGATTAAATTAACCAGGCGCTTCGGCAGCCGCTTCTCCCCTGCAATACCCGGGAATATTGATCGAAGCACTTTGGAAGCTT
CACTTCGACTGACCAGCTCACCTGCCGTCGACATCTTGGATGATTTGACCAGTACGTGAGAGCTTGCGAAGACACGATCTTTTTGAAAATGACGTGCATA
CATCACTTGGTTGATCGATACTTCTAACTTGTAAACAACATCAGGTGCGGGATTCTGCTGTGTCTTTGCATTATTGCCAGCTATCAACGCAAGATCTTTA
CGCAGACTTTTCCCTGCAAGCTGGCATGATCACAAGGGCACACATATAAAATCCGTTTAATGTGTTCGAACCAAGTATCCACATATTGTTCCCTCTAAAT
ACCTGGATATAAGAGAGTCGAGCACCCTTTACTTGAGCAAAAATCGTATAATTCAGCAGGAGGTGATTCATGAGATCGTCGCCCATGAGCTGGTGTAGAG
ACTCCCATAGCGGTTTTTTTAAAGTGGACACCAGCGTATTCGGATAGTAACACATGATCCCATTGGACTGCGTCACTCGATGACCAGAAGCTCCGGGAGT
CACTTCTCGATAACCGAGCGTGAGGATATTCGCATCCTCCCAGTGACTTGCAGTTCGCTTCCgtgcaagaagatgctgtaaAATAAATGAATATATATCA
TCTAAATATTTAACTATCCTGAACAAAACAATTCAAATAATAAACATAAGCATTTCCTCACCTCAATAACATGGTGAATCAACTCTGTCTGTCAAAATAA
AGCAGCATAATGCAGATAGTAATAAGTAAGCGTATAATATGACAGCCCCCGGATGAACTATGGTTAAATCTACATATGAGATGCAGTTGTCACAGCCCCA
AGGAGGTCTGGGAAGAGCTTCCACCGCTTCAGATTTTGACTGGATAAGGAACGTCTGGTCCAGTGCAAAGCAGACATCCGGTCTCGTCTCAACTGCGAGC
TTCTGCTCAAGCCTGGGGTCTTCATTGGCGCTGCATTGCAAAGCAGCTCTAATACAAACAACGACTGTAAAATAAAATCCGACTACACATGGAAATCACT
TTCGAATATACGCTGTGTTCACCTCTGCAGGAAGCAACGCAGCGTCTGCGCCTTGGTGATCAATGCGTCCATTGTAGAAATGCAATAGAAAAATAATAGA
AATACAATAGAAACACAATAGAAATGTTTTTATCTAAATAGAAATGATAAGGGAAACTTCAAGATGGCTACGCGGAACGAAGCGCTCGAGCGTACGGCTG
GGGTGATCGAGGCCAAGGAAACTGCGCGTCTAGAGGGGCGAGACTTCACTCCAACTGGTTTGGCTGTGGATCAGGAGTTTCTTCGCACGCACGAGGCTGC
GTTTGGACCGGAAGAAATGGTTTTTTACGAGGGTTACGCGTGGATCTTACTATCGCTCTTGGTGCCTTTGTATTCTGTTACAAAAGCACAGAGAGCTGCC
GGACAGGGCAATAAGGGCTTCCTACTAAAGCATTTCTTCGCAAAGGAATATCTATTGGGGTATAATGATCATTACGTCATAATAGAGGGCGAGCCGCCAA
GAAAACGTAAACGCGGAGACCCTCAAGTGTTCGTTCGTTTGGCTCGTGCTGTGTACCATGAAGACCAGCAGTTACAGGGACATATATGGGCCTTGGCAGG
CAAGAAACGCatggaagagatgaagagatgCCCTCGATATGACGAACTAGTACCGGTAAATCGTAATCTGGGGGCGCCGCGACTCATATACGGAGATCTt
caaactgcagctgatGATAAAAACACTGCTGTTGTCTATCTCCTGCAAGGTGAACCTCTACACAAATATACCAGTCAAATGAGAGATGCTGTGGTGTTTC
AAGTTGGAGTGAGTGAGGGGCAACAGCTGGAGGAATTGGAACAAGTGCGTGAACTTCGCTCGTATGGGAGAGTTCGTTGTCTTTGGTTCGTTCGTCTAAG
TAAAGATcgcgctgaagaagcagagacCTGGCTGATGGACGAATTGGTACGATTGGGGGTTGTATACCCGCTCCGTGACAACAAGACGGGGTTGGTGACA
GAGATACCGATCCTCAGAGCAGCTCAAATTGGTCTGCTTCAAGATGTGTTCTGCCGTCTCGCTGAGAAGTTTCAGGAGTCGACAGCGCCCGATCAAAACA
TTGAGTTTGCTAACTCTGGTGTGGAACGAACTGTGCCCCAAGCCTCACCACCCCAtcttcctgttcctgttcgcATCATGCCTTTTCCACCCCGCATGTC
CTTCCCAATGGCTATGCAGGCGTCAGACCAGGGTTACACCAAGATCCTGCCAAAATTGTAAGGCAAACAACGTTCCACGTCGAGTAAGTGGTGCATTTCC
TGCATAACGTTGTGTAATTTAAGCGTACGTGTATTGTTCCATCCGAAAAACATATTTGCACCTTGAGCATTCTGTTTGTCGAATCAACAGCTTACACTAC
GCAAAGGCACTGTTCAAGTCTGCAAAGAGAAATCAGTGCTGTGGGTTCATACCTCCACTCAGCAGTTCTACAAGTGTGACTTACTTGGCgagctagcagc
agcacggaaTGGCTCGAGGTCCTTCAGGTTCTCAATAATCTTTTGGCAGACTGCTGTTGGCTTCTCCATGATCATAACGTGTGAGGCATCTGGAATCGGA
TCTTCCAACTTGTAGATACTTGGCCACGTGTCGCTGATCTCTGCGGCAATCGGTGGCATGAACATTTTCGTGCGCTCTCCACTGTGGAAGTAGATTTTGC
ACTTTGGCtgagcgagctgctggtcgttCAGGTTCAGAAGCTTGTGGCAGTAGAGCG