Description :
From Genome Similarity Track
Location :
Scaffold_89:226688- 229786
Transcript NameFunction/comments
Aphas_H257_16074phospholipid-transporting ATPase, putative

Sequence
3098 bases(100 bases per row)
GGGGAATACCGCAAGATCTACCTCAATGACGCGGCCAAGAATGCCGAGAGCGCGTTTTGCGACAACGTGGTCGTGACCTCCAAGTACACCGCCGTCACGT
TCGTGCCCAAGTTTTTGTTTGAGACGTTCCGCAAGTTTGCCAACGCGTACTTTCTCGTCGTGTCCATGATGCAAGTGATTCCGTCCATCAGCAACACCAA
CGGACTGCCCTCCACCGCCCCCACATTGCTCTTCATCATGGTCATCGACGCCATCTTCGCCGTCCTGGAGGACCGAAAGCGACACATTGCAGACGCCGTG
GCCAATTCGAGGGTCACCCGTGCCTTGGCCAAGGAAATCGAGCAGTTCAAGGCCATTGAGTGGAAAGACCTGCGTGTCGGCGATATTGTCAAGTTGAGCA
ACAGGGACCAAGTGCCTGCTGATCTAGTCATCCTCGCGGTGGCAGAACAGCCGTCAACGCCGCCCACGGGGCTGTGCTACGTGGAAACCAAGAGCTTGGA
CGGCGAAACCAACATGAAAGTTCGCCAGGCGATACAGTGCACCATGACGAAGTGTCAGTCCCCCGGCTCCCTCTTGGCACTCAAGGGCATGATCCAATGC
GAACACCCCAACAACGGCATCAACACGTTCCAAGGCGTGCTGCACCTCGACAGCGGCGACAAGGAGTCCATTGCGCACAAGAGCATCCTTTTACGTGGCT
GTACGATCCGCAACACGGACTGGGTGCTTGGTTTGGTGGTCAACACTGGCCAAGACACGAAAATCATGATGAACAACACGAGCACGCCGTCCAAGATGAG
CTCCATGGACGTGTCCATCAACCGATACATTGTCGCATTGGTGTGTGTGCTGTTTGTGTGCTGCGCGGTGGGCGCGACTGGCAGCGTGCTGTGGGAAACG
AAAAACTCCCACACGTGGTACATCCATGGGAAAACGCCATCGCAGTCGTCGTGGGTGGTCATGTTCTTTTACTTTTTCCTGCTCATGTACCAGTTCATTC
CCATCTCGCTGTACGTGTCCATGACCATGGTCAAGCACGTACAGTCGATATTTCTTCAGTGGGACGTACAAATGTATCATGACGACACAGACACGCCCGC
GCTCGTGCGCACCATGTCACTCAACGAAGAACTGGGCCAGATTTCGTACATCTTCTCCGACAAAACTGGCACGTTGACGTGCAACATCATGGAGTTCCGC
AAGTGCTCCATTGGAGGGGTATCGTATGGCCACGGGACCACCGAAATCGGACTGGCGGCGCAGCAGCGCGCAGCAAATGATGGCTCGTTTTCTGCAATAG
CCGAGGAAAAGCATCATTCAACCAAAGCGAAGTGTGTGCCATATGTCAACTTTGACGGGGTCGAGCTGTACGAGCACATGGCAGGGTCGGGTGGCGCTGA
CCAGAAAGAGCGCATTCACCGGTTCTTTCTGCATTTGGCCATTTGCCACACTGTGATTCCAGAGTATCGCCAGGGCACGACTGAAGTGACGCTGTCGGCG
TCATCTCCGGATGAGCAGGCGCTGGTGAGTGGCGCCGCTTTCTTTGGTTACGAGTTTATCAACCGAATGCCAGGCAAGGTGTCAGTTCGAGTGCGGGGCC
AGGACGTACAGTACGAATTGCTGGACGTGCTCGAGTTTAGCAGTGCACGAAAGCGCATGTCCACCGTGGTGAAAACTCCCGACGGCGACATCCTCGTGCT
GACTAAGGGCGCCGACGTTGTGGTGTTTGAACGGCTCAAAGCTCAGAACGATGCCCAGATGGTGACACACACGACCCAGCACATCAACAGCTTTGCCGCC
GAAGGCCTCCGCACGCTCACGATCGCGTCCAAGCAAGTGGACGCGACTTTCTACGGAGAATGGAGCGGACGGTACCACGACGCGCTCAACAACCTCGAAG
AAATGGATAAGCAAAAGAGCGAACTGCCCAATGCAATCGACGAGTGCATGGAGGAACTGGAAACAGACCTGGACCTTCTCGGCGCTACGGCCATCGAAGA
CAAACTTCAGGCTGGCGTTCCGGCTACAATTGCCTCGCTGGCCGAAGCCGGGATCAAGATATGGGTGCTCACGGGCGACAAGGAGGAAACGGCCATCAAC
ATTGGGTTTGCATGCAACTTGCTGCACAGTCGCATGCGACGCGTGGTAATTAACTCGACGCTGTTTGACTCGGCGCAGAAAATCGAGGCTGAGCTGCTGT
TGCAAGTGGCTGTGTTGTGCAAAGAGGGTTCATCGGCAGACGAATTCGTGGACGTGGCCCTTGTGATCGACGGCGACAGTTTGATTCACGCGTTGAGGGG
GTCCTGTCGGACCGCGTTGTTGGAGTTTTCCCAGCTCTGCAAAGCAGTTATAGCGTGCCGAGTGTCGCCTGGTCAGAAAGCGGAAATGGTCGCTTTGATC
AAGGACAACATCCCCGGCGTTCGCACGTTGGCCATAGGAGACGGCGCCAACGACGTTCCGATGATCCAGGAAGCCCACGTGGGGGTGGGTATTTCAGGCC
AAGAAGGACTCCAAGCTGTGAACGCCAGCGATTACGCCATCGCCCGCTTCAGCTTTCTAGGCCGGCTCATCCTCGTGCATGGTCGATGGAACTACATGCG
AATGTCGCAGCTGGTGCTGTACATGTTTTACAAGAACATTATGCTCACGGCGGCGCAGTACACGTATACGTGGATGAGTGGGTTCTCCGGGCAAAAGTTT
TTTTTAGAGTCGATTGTCCAGCTGTACAATGTCCTATTCACGTCGTACCCGATCCTGTGCCTGGCGATCTTGGACCAAGACGTGCATGATACCATGGCCG
TGAACTTTCCAAAGCTATACGTGGCTGGCCCCCAAAACGACCTCTTAAACGCATCTGTGTTTTCTGCGTGGGTGGCGTCTGCGTTGGGGGAATCGGTCGC
GATTACGCTGACGGTGATGTGGTCGTTTCGGGACTCAAGCCATTCGTCCGAGTCCCCTGGCATGTGGCTCGTGGGCAACGTCGTGTTTTCGCTCGTGATG
GTCGTGGTCACGATCAAGTTGACGTTGTTTCAAAACTCGTGGCTAGGCATCAACGTCGTGTTGTACGCGATATCGATCTTGTTGTGGATCTCGATTGC