Description :
From Genome Similarity Track
Location :
Scaffold_265:22667- 25168
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_265-abinit-gene-0.4314-3-3 protein epsilon
Pytir_DAOMBR486maker-pir_contig_265-snap-gene-0.29Cell division protease ftsH

Sequence
2501 bases(100 bases per row)
GAGCTCGCTAGGCGAGGTTTATCCTCTGATCCGAGCAATCTGTCGCCCTACAGCAGCTGAACTACTCGAGCAATCTCCACCTGAAACGATCGCGTTCGAC
ATTCAGACCGAGGTGAACAGCATCATCCGTCACATGGTGCCACTCAATATCGCAGACTGTGAACTCAGAATTCGACCAGCTATCCCTTCCTAGCCCTCTA
TTGGAACGGGGATTCCAATAAACGTGCAAGAGGCTCAAGTTGCTGTTGACGTGCTCCCCAAGCTGATCTGTGATCCAGGTGCGAGCTATTCGAGCATCGA
CAGCCTCTGCGATGGGACCTACATCTGTCATCTCGTGACCATTTGGAGAGATGCCTTTATCACTATTCCGCTCTTTCAATCACGGTCGTGGCAGAGATCT
TCCGAGTACGTGGGCTATAACCACCTTGCTTTGCCCAGACCAGGGTGTTCATGGACAAGTCTTCAATGAGCGGCTAGGATTGGGCTGTCGTTGTCTTTTG
ATAGCGACTGTGATACAAGCATGCCTAGCGAAAAACGAACGAAGTACCTAACGATATCCAGCGATTGGCTCAGTTCTTTGGCTTGTCTTGTAGCTCCTCT
CCTTCCGTTGTCCATAGCATGAGGTTGCGACGGAGCAACTGCATGATCATTGTGCTATCGCAGGACGGGTCCTCAGTGAGCGTGTCCAACTCTGCGATCG
CATCGTCAAACGCTCGCTTCGCCAACCCGCAGGCTTGTTCGAGCGAATTGAGGATGTCGCAGTAGAAAACAGAGAAGTTGAGCGCCAAACCCAAGCGGAT
CGGATTCGTCGGTGCCAACTCCGTCATCGCGATCACTGACGCCTCCTTGTACGCCTCAAGCGCGTTCCTCGCACTCTTGGCGCGCTCTTCGTTGAATCGA
AACTCCGCGATGTAGCGGTGGTAGTCGCCTTTCATCTTGCAATAGAACACTCGCCCTTCTCCGGAGGACGACTTGGAGAGCAAGTGCTTGTCAATGATGG
CGAGCATGTCGGTGCAGAGCAGCTCCAATTCGCGCTCGATCTTGAGACGATACGCCTTGATATCATGAGTCGCTGTGGGGTCGTCGTCGCTCTTGGTGTT
GCTTTCGAGGTGTGAGATCGCGCGCCACGACGCGCGACGCGAGCCGATGACGTTCTTGTACGCCACCGCGAGCAGGTTGCGCTCCTCGACCGTGAGCTCG
TCGTCAACACTGGTTGCGACGACCGTGATGTGATCCACCATGTCATCATAGCTGTAATGGATTGGGCATAGAGTTATACGTGAGTTGAGTGTCGGATATT
GCTCATGCTTGGCACACTTTGCTCACTTGTTGTGAAGTGCATGCCTGGAACGCACCGCTCTGCATGTTCGTCCAGTGTAGCGAGAAAAGTGAGGGCTTCG
CGGTCCATGATTGTTAACAAAGATGAGCTTGGACTGACTGGCAGGCTGATAATCTCTGCTGTGTGAAGTTGAGCAAGTTGGAGAATGAGCATGTTTGTTC
TCAATCCTCAGTGTCTTCGCGTCTCGAGAAAGCCATCAAGCTAGGGTGATGCCTACTATAGCGAATGCCGAGCTTTCTCGATCAGCAAGCGTTCCCTTGC
ACCAATCGCTGAGGCCATTCGCCCTCTCGTTGCCTGCGCAGTTGATAACAGACCGTGAACAGCTATGTTGGCCATATTGAACTTGCCTTTTACCACCATT
CCCAGAGGAATGTGTGTATTTTCGTCATTTTGATTGGCTCCCGGTATTTGTGACGCATCAGTTTTAACAAATCACAAAAAACAAAGACAAGACATGATTG
ATTGGCTTGATCGAGTGATGACGCGTCATTTTCAGCCAATAGTACATGGCAGCAATAGAGGAGGCTTGATGGGAGCTTCACTGTCCACAGCATGTAGACA
TCCAACAGCACAGCAGTTGAAAACATCAGCAACTGCATCTCAAATCTATCCTCGCTTTCGGATTTCCTACTCCGGCATCAAAACTCAAGTGCGAAGACAC
ACACAACAAATCCAAATCCAAGCAAGCGCGGATGCTTGGAGGCTGAATTTTCGTGTTTGAGATTCTGAATGCCATCGCAGTCAAGCCGTCCAGTCTCTAC
GAATTCGAGCAGATCGATATGAACCATCCGACATTCGGTGACGTGCTGTGCGCGCTGGAGAACAACACTTGGAGCCACCGCAAGATCCCACGCACGACCA
AGCCACTGGAGTTCGTGCGATGCATCTCGAACTTGATGATTCAGAGGCAGTAGGAGGTTTCAGTAGCTGTCAGTATGTTGATAGCGCTCGCCAGGAACAA
AGCTGCTGTTCTAGATAGATATTTTGGTAGTGACAAATGAACAAATCCTCCGTTTCTATTGACAGATAGTGCCACATACCAACCTTTGCTCTCATCATTC
ACCCTCACCGTTCCTCATTAGTTCGCGTCGAACTCGTACGGCACACCAGTCAGGTTCTTGCTGTACGCCTCGTAGGCACGCGCCATCGCGAGCTCAAAGT
G