Description :
From Genome Similarity Track
Location :
Scaffold_37:226603- 227991
Transcript NameFunction/comments
g9283.t1XP_009538428.1 hypothetical protein PHYSODRAFT_307409 [Phytophthora sojae

Sequence
1388 bases(100 bases per row)
CTGCCCGCTTTGGAGCACCGCGAGGAGCTCCTGGCAGCTTTAAAAGACCATCAAGTGGTGGTCTGTGTAGGAGAAACAGGGTCCGGAAAAACAACGCAAA
TCCCGCAGTTTTTGCACGCCAGTGGGGCCTACACCAGTGCCAAACGAGATTCCGGAGACTTAGCGCAATGCGTCGCCATTACGCAGCCCAGACGAGTGGC
TACAGTGTCCGTGGCTCAACGTGTAGGGGAGGAAACGAACTCCAGAGTGGGGGGCAATGGAATTGTGGGTTACGCCATCAGGTTTGAGTCGCGCTGCAGC
GACCAGACGAGACTCAAGTTCCTGACGGACGGAGTGCTGGTCCGAGAGTGCTTGAACGACCCGTTGCTCAAGAAATACAGCGTCGTAATGCTGGACGAGG
CCCACGAACGCAGCATCCACACAGATCTGCTGTTTGGGTTGCTCAAACAGGTGATGGAGCGACGTCCAGAGTTCCGGGTGCTCATCACGTCCGCGACGTT
GGACGCGGATCGGTTTGCAGAGTTCTTTGGACAACGGACAGAGGAGAAGCACAAGAAGAAAAAGAGAATAGAGAGGGTCAAACCGTGTCCAGTTGTCAAA
ATCCCTGGACGAGTCTTCCCCGTGGATATCTTCCACTCCAAGCAGAGGCAGATCATGGGACATCGAGGCCCCTTGTCGACGTATGTGCGTGCTGCCGTGG
AGACAACGATGCAGGTGCACAATAGCGAGGAGCCTGGACATATTCTTGTGTTTCTGACCGGTCAGCGGGAAATTGAAGACGCTTGTGCTCAGCTCCGCGC
ACTTTATCGAGAGCAGCCAGACGAACGAAGGGGTGAGATGGAGCTGCGGGTGTTGCCGCTGTATGGCGCGTTGCAAGGTCGGCGACAGCGCGAAATCTTC
GATGCAGTACCTGTGGATCGTGTACGCAAGGTGATTGTCGCTACAAACATCGCTGAGACCTCGCTTACAATTGACGGCGTTCGCTACGTGGTAGACTGCG
GCTTCACCAAGCAAAAAGTGTACAACCCAGCGCAGCAAATGGAGTCGCTGGTGGTTGTACCGATCTCCAAGGTGTCGGCACAGCAACGTGCGGGTCGTGC
AGGCCGCACTGCACCTGGAAAGTGCTACCGGCTTTACAACAAGGTATCTTATGAGGAGATGGCCCAAGAGACAGTGCCTGAAATTCAACGCACGAACCTT
GCCAACACCGTGCTGTACCTAAAGTTGCTAGGTATCCAGGACGTGCTTGGATTTCCATACTTGGATCCACCGGACGAAGACTCGTTGCTGGATGCTTTGA
AGCAGTTGTACGTCCTCGGCGCACTGGACGCCTCTACTGGCGAAGCTACACCACTCGGAAAACTGATGGCCGCTTTCCCGCTGGAGCC