Description :
From Genome Similarity Track
Location :
Scaffold_55:2266- 4643
Transcript NameFunction/comments
Phyta_totarag2380hypothetical protein

Sequence
2377 bases(100 bases per row)
gtcgctgctAAGTATACTCTGCGCAATCCTGCTTCGCCATCTGATCCGCTCAAGGCTGCTTCAGattcgctgctgtcgtcggtCACGTGGTTCGCTCGAA
CATCTCGGGTGGCAGAGGGTGCGGCAGTACCACGGGGTCTTCGGTCTAGATTTGATCGATCCGTAGACCCATCTTGGTCTGCTGCACCTTCGTACGCTGT
AGAGGTCGCAGTGTTTCTTTCAGGGTATCGGCATCTGGAATCCGCAGCAACACAAGGTGATCAGCAAGATCGTGGTCATCAAGGGTCTCGATGAAGTGAT
CGACATGCTCATGGCGGAGCTCCGGCGATCCAACTTTGACCTAGAGTCGCGCGCGTAGGCCAGCCACGTTGAGCCGACGCAAGTACTCCAGAGGCGTTTC
TTCCTAGCGCTTCTTGGCATGATAATGACAATACAGTCTCGCAACAGATACACCACGGTCACAGTACTGCTTCTGAAGCTCTGGAGAAGGTCCTTCCTAG
TGCTGCGTGTTGTGCGACTTAGCGTCGGTACCAGTTTCGGGCTGGTCTGGTGAGAAGATCACCGGAGACCAAGCACTTCTCTTCGTCCGGTGCCTGATCT
CGGATGAACGCTGACTTTACTTTGCCGAGCCACGATCGACCTCGATTTTCGTCGGTATCCTACCCGGCGAACTCCTTCAGCCCAGCCATTGCCGACACAC
GGATGCGAGGGGCAGGCGTCGATCTTCcgggagctgctgtcgtggccattgctgctcgtgcagaCGTGGCGAGAAGCAAGATCATCGGGGTCGTCCTCTC
ACGACGAGGAGTGGTGGTCTGGTGACCCAGCCGACTCCATTTCCACATTTTCATCTCCAGTCGGCATTGCACTTCGCCGGTTGTGGAGCGGCTGTTGCTC
CTTCAGGAAGCGCCTCATCGCTGTCGGAAAGTataacttcaacttcttgtATGAGAGGCGTTTCGGGCTCGCAGCTGCGATTTTGGCCTCGTGGACGGAG
GATTCAGCAGTTTTCTGGGCACGTGCGATTCAATCTCGCAACGTAGCTGCACCGGACGGTCCCAACGTCGTTTGTTGTGTGCCGTCCGCGCTGTCTGtgt
caacttcttcgtgtgcTGACTCATAGTGCGACGACGTTCCGGTCTGATCGTCCGGAGTAAGCGTTGGCTGGGATCTAGCAATCGCCGGCGTTGGTTGCGA
TCTCGCAATCTCCAGCACTGGTTGCGATCTCGCGATCTTATTGGGTGGATAGCTAGCTCCGCCAACCAGCTGTTTCAGCATTGCGAAGAGAGTCTTGAGC
GCATGCTCGACCTCGCCCAGCTTCAGTTCGAAGAGATCGTCAGCTTCAAACGCACCGTCGACGATCCCGGATTCTGTCAGCAGTCggagcagcgccatca
cTGCTTCCAGCTTGTTCGATCCAGCGGCCGGTTCCGACACAGGGTCCTAGAGATCGCCGAGCATCTTCGGGCGAAGTATCAGCATCACTGTGTTTTGCGT
CAGGAAGGCATGAAGGTCATTCCTGTAATACACAGCTTCCAGCGATTCGTCGGTCCAGGTTGGCTCAAGATCGCCACGACCTTCGATGTCGAAGTCCGga
gccttcatcttcttctgcgaggACTTCGATCTCGCGGAATTGTGCTTGGCACTCGACCTTGGACCAGGTGGTGGGGTGGATGAAGTACCTCCTGCTTTTG
CTAGTGGTCCTTCGTCTGACGGGTCTCGATTCGCGTCGAGATCTGCGGGGGTCTCCGTAAGGACCTAAGAAGGAGATTGGGGGTTACCTTCCAGGTGCGT
CGCCGGTCCTTCCTCTGTTTCATCGGTTGAGCTCCTCTCAAAACTCTGCCGATCCGCGGATCGATCTTGATTTAGCAACGTCGTCGGCGATCCGATCTCC
GTCGATTCTCAGCATGCGCTTTCCTTTTCAGGGGACTCACGGCGAAATCCCCAGCCACCCAAAGATCCAGGCACGCGCGCCATTGTGGCAAAGTGGGTTG
TGAAAGTTTTAGATCGCAGGTCtctctcacacacggcgcccgaactgccgactaacggagggtGCATTCCGATATCCGTGGGGATAGTTGAGCCTTGCTC
ATCTTGTATATCCGTCGGTAGGGCAgggtcgctcttcgggtgatctcggaggagacgctaGGTGCTGAGGACTTGGACTGTCTGTCGGACAGCGAgaact
tgtggcagcaacGCAGAAACTTCTTCGCGGTGTGTCGTTGGGGCCGAGTCTGTGATCTTAATCtgtcgagatcgcgactcgAACGCCAGAGTCGATATGG
GCCTAGGATGCCTTGTTGCGGCGTGCATCCTTCCTTCGCGGTGCTTATCGCTTCCTTTAGCGGGGTCTTGAAGTGAG