Description :
From Genome Similarity Track
Location :
Scaffold_248:2266- 3590
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_248-fgenesh-gene-0.5Arginine biosynthesis bifunctional protein argJ

Sequence
1324 bases(100 bases per row)
ATTTAGGAaCGGTAATCAGCGTTGATGGCGACGTACTCGTGGGTAAGATCAATACCGAGGACCTGCGACTTCTCATTGCCGATACCAAGGTCGATGTCGA
TTTCGACGAAGTTGCCATGCGGTGGGTAGTCTCGCGAGGTGACATCCAGGCCACCACGAGTTGACTCGGTAAGCTGGGCGCGCTGCATGTGGCCGACAAG
AAGGTGCTCAATCTCACTGTTGAGCACAAACTCGCCGTTCTCAAAGATCGAGACGCCACCCATGGTAATCTTCATGCGGCGCGTGATGTCGAGCTCCTTG
TGGTGCTGACCCATGTACTTGCCAACAGCCATGACAAGTCGACCAACGTTCGGGTCGTTACCGGCGACCGCGCACTTGAGCAGTGGCGAGTTGACGACCG
ACTTGCCAACACCCTTAGCCATCTCCTTGGACTGAGCACCGCGCACAACGACGCGCATCACGTGTTGTGCACCCTCACCATTGCGCACAATGTCTTCACA
CAAACCCTGGCACACTTCGTGAAGTGCCTTCTTGAATTCCTGCAGCTGCGAGTCTGAGTCGAATGGAATCTGGTCGGACGACACAATCGCAACCGTATCA
GATGTGCTCTGGTCCGTGTCGATGCTCATAGCGTTAAAAGTGTCACCAACAACTTCCTTCAGGAGCTGACGCAGAGTCTCGCGGGGCACCGAGAGGTCCG
TGAGGATGTACGAAAGCATCGTGGCCATGTTCGGCTCGATCATGCCCGcACCCTTGGCAATACCGACAATGCGACCTCCACAGACGTCCACCGATCGGAT
CTTCGGGTAGAGATCAGTGGTCATGATACCTTCAGCAGCAGGCAGCACActCTCCGACTGGAGGTTCTCAACGAGTTGTGGCATAGCCTGGATCATCGAG
TCGACTGGGATACGCCAGCCGATCACACCCGTGGAGCTAGGgAGCACCACGGCACTGTCTtCCAGACGAAGATGCCTCGACAGAGCATCACACACTTCTT
GCGCGTCTGTGACGCCTCCGCCACTCGCACACACGTTCGAGATCTTGTTGTTGACGaGGATCGCACCGAGCTTTTCTtCGTGCAGGCGCTGgCGCCCAaC
GATCACCGGTgCACCTGGGAACGCGTTCGATGTGAACACTGCACCAAAGAGCGACGTCGGCTTGACTGGCTTGATCAGACTGAGCGTCATGTTGGCTGGC
AGGTGTGGCGCCTCTTCCGGCACGAACTCGAAGTTGGTGGTCGCGACGGAGAAGCCCCATGGCAGGCGGCTGTGGTGCTTGGTCAGATAGTCCATGTACT
CCTGACGCGAGTCGAAGACGAACG