Description :
From Genome Similarity Track
Location :
Scaffold_13:22659- 24540
Transcript NameFunction/comments
g18293.t1RAW31866.1 Tyrosine aminotransferase [Phytophthora cactorum

Sequence
1881 bases(100 bases per row)
ATCTACTGGTGGCGGAGGCAGAACTCAGCAAGACGAGAATATGCTTGAGTGAGGACCTCCTGCGGTGCTGAAAACACGATTCGGAAGTAATTCGTCATTC
CAAAACACTACCAATGATACATACAGCAATGCTTAGTTGTGTGCGCAATACGAAGCAGAAACCAAATCGTGACACGCTCCCCCGATAACCTACCTGGCCT
GGCAGTACGAAGACAGATTCTTCATCCAGCAATTTCTGCGTGAAGTCGAAATCGTCCGTGATCTTCGTCAGGACGTTGGTTTTGATCTTTATCTGCAAAC
ATTATGGATAGATCAGTGCTACAAGCATCGCATTTCAAGCACTCTGCTTTGGTACGTACCATTGCGTACATTGCGCCTTGCGGGACTACCACTTCCAAGC
CTGGGATGTTGGTGAGGATTTCGACAGTGAACTTGGCATTGTTCTCCAACGTTGCGAAGTAGCGCTTTTTGAAGTCACCCAGCAATTGGTCTTCGGCACT
CCCGGAAACCGGAGTTAGTATATCTGGAATGGCACTCTGGTGGTGCAACACAGGTTAACTTATCTTTGAATAAAGCACTAGCATCATGGTAAGGCTTTAC
CTGGACTAGCGAGCTCGCTCCAAGGACGCTTCGTGACAGATTCAAGTAGGCGGTCCGCACGTCTTTCAAAATGTTGTTGCGGTCGTGAACGACGAGCCAG
CCTACTCTCCAGCCAGGGATCAGGAACTGCTTGGCTAACCCACCCACGGTTATCACAGGAACCGTCTTCGTCAGTGCCGCCATCGGATAGAAAACATTGC
TTCCAAACACCATGTCTCCGTAGATTTCATCCTGCGTGCCAAAACTGTTAGTGTTATGGATTCAGCAGGCTGAAAGAGAACGTCACTTACTGCAATGATG
AGGACCTTGTTCAATTCCGCCAAAGCGAGAATTTTCTCCAGGTGGGGCTGCAGAATTGGATCAATATTAGAACTACGTCGCACAAAGGACAAACTTGTCG
TCGAACCTTCGAGTACACGCTACCGCAAGGGTTGGAAGGATTATTCACCAGGATAGCCCTCGTATTTTCATCCACCAACGCCTGCATGTGCTCCAAATCG
GCCTCCCAGTTGCTCTCCGGCTGGCAATAGCGAAGAGTACATACTCGTCAGCACAAACGCAGCTTCAAACTGCGTGTAGCAGACTCACCTTCAGCTTGTA
GAATTTGCATTCGATTTGGTTCAGGTCGCAGAGTGCTTGATAGAATGGAAATCCAGGCCTGGGGAGCAAGATATTCTCTCCAGGGTTCAGCAGACCTCGG
AAGGCAATGTCGAGAGCACCCGAGCACCCACTTGTGATGATGATATCATCCACAGTTAAGGGGGCCTTGGAGTTACCGTAGTGGTGCGCAATAGCTGCCC
GGGCAGCCTCCGACCCAGCGGAGTGGATGTATCCGTTATGCTGCATGGAACTACCGTAGTAGTACACTAATTAGTGTCCTCTAGTTTAAAAATGAAGAGT
AGATAGCGACGAACCGAGTGTTTCGGACGATGGCCTCGACCAGTACGTCGGGGCAGTGCAAATTGCCGAACACCGTGGGGTCCCCTATCACAAAAGGGGG
TCGGTTAATTCTGAATGGCACTCTTGTGCGTGAAACTTGACGGATGCACGAACCGAGTGACAGCGGGATCATGGTCTTTGAAGCGTTCACGGGTTTCTTA
ATGCTGTCCACGATTTTTCGGATGGGGTTGAAGCACCGCTTTGACGAGTCCGACGGCTGCACATTCCACTTCGACTGCTGCTTGGCGTCGGTTTGGGGGG
TGTCCAAAATGGACTTGGCGATGGTCATGGCGATACTTGAGATCTAACGTCTATCTGGTCAATTGAAAAGTGCGTTGACTG