Description :
From Genome Similarity Track
Location :
contig_55:226581- 227584
Transcript NameFunction/comments
g9286.t1hypothetical protein
g9287.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TGTCCGTATATAGATCGTTGGGTCGGTTGGTACGGCTGGCAGTCGCAAAGTCGACGATGTGCTGGCGACGGACGTGTACAAGCTGTAGAGTATCTGGTTT
CACAAGAGGAACGTTGTCGTCTGGTGCATAGGGGACGGATAGGCCAGACATTACCGTGGGGGGGACGCCGGACCTTCGCCTGCGACAGGCTTCCAGGATT
GAGTCCTGGTGATGAAGTAGCTCCATTGGTCCTAACGCAACCGCGTTGGCGCCCTGTCCGGGTTGTAATGCGTAATTAAGGGAGTCCACCTTGATCACCG
AATGGGCGTCTGTCAGAGGCAATCGAGTCGGCCCTTCGGGGCTCACGATATGCAGGATATCGGTCGTTTCGGATGCTGTGTAGCCCGAAACGACCCCGTA
CGACCATGCATCGACGCCAGCTGGTGATGTGTGTACGAAGGCGACCGTGTGGGCTATGTATGACCCTGGCCAAAGTCTGCGTTCAGCATCTGAGACCATG
CGACGCATTATGGTGTCCTTTGGCACTTGAAACGTGACTAGCCGAGCGCCGCCCGCGTTGCGGGCGGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCG
CTCATCCAGCTCGCTTCACTACTGTTTTTGCTATGACAGGCTTATGTTTTATATCAGTATATTTTACAGTAGACTTGTATCAAAACCCTAAGCCCGCTAC
GGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACTGCTTGGTCCTGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTACTCGC
TGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGTCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCAATGCACTGCTTGGTCCTGG
GTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTGCGCTCGCCTCCTCAGTATGTGTCGCTCCTACGCCCTCTCGAACAGCT
GTC