Description :
From Genome Similarity Track
Location :
contig_55:226551- 227577
Transcript NameFunction/comments
g9286.t1hypothetical protein
g9287.t1hypothetical protein

Sequence
1026 bases(100 bases per row)
GATGCGCCGGAGTTTCTGTGACCGGAGCGTTGTCCGTATATAGATCGTTGGGTCGGTTGGTACGGCTGGCAGTCGCAAAGTCGACGATGTGCTGGCGACG
GACGTGTACAAGCTGTAGAGTATCTGGTTTCACAAGAGGAACGTTGTCGTCTGGTGCATAGGGGACGGATAGGCCAGACATTACCGTGGGGGGGACGCCG
GACCTTCGCCTGCGACAGGCTTCCAGGATTGAGTCCTGGTGATGAAGTAGCTCCATTGGTCCTAACGCAACCGCGTTGGCGCCCTGTCCGGGTTGTAATG
CGTAATTAAGGGAGTCCACCTTGATCACCGAATGGGCGTCTGTCAGAGGCAATCGAGTCGGCCCTTCGGGGCTCACGATATGCAGGATATCGGTCGTTTC
GGATGCTGTGTAGCCCGAAACGACCCCGTACGACCATGCATCGACGCCAGCTGGTGATGTGTGTACGAAGGCGACCGTGTGGGCTATGTATGACCCTGGC
CAAAGTCTGCGTTCAGCATCTGAGACCATGCGACGCATTATGGTGTCCTTTGGCACTTGAAACGTGACTAGCCGAGCGCCGCCCGCGTTGCGGGCGGTGG
GTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTGTTTTTGCTATGACAGGCTTATGTTTTATATCAGTATATTTTACAGT
AGACTTGTATCAAAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACTGCTTGGTCCTGGTTTTCACCCGCGTGCTTCGC
ACACGGACTTCAAACCGCAGGCGTACTCGCTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGTCCGCTACGGCTCGCAAGCTTCGCCTCCG
CTTGTCTAGCAATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTGCGCTCGCCTCCTCAGTA
TGTGTCGCTCCTACGCCCTCTCGAAC