Description :
From Genome Similarity Track
Location :
Scaffold_95:22653- 25764
Sequence
3111 bases(100 bases per row)
CGCTATTTTTGCAATCCCGTTCTCTTGCTAAACGTACGCGTTCGTGAACTACTGTACGATGCCATGTTCAGTAATACTAATGCGGCTTGGTTCCAGCAAA
CGCACCGTCTTGGTCCAATCGAAGCTGTAGCACCTGTAGCCTTTGGGATGTGCCTCAAGCTCCCTTAGTAGTTTCAGAATAACCAAGTAGCTTATATCGT
CTTTTCAAATAAATATGCTCATTTGTAGCTTGTAACAACATCCACAAAGAGCATGAACAAGGTAGTCCTGGATGATGTCTACACGTTTATACCACATATG
TTCATTTCCAGCAACTCATGTGGTTTAGTCGTGTAGACAGGATGCCGCTTTTGGCTCATTGACTTGGCATTACTCACAACACAGCCAATGCATTTGTAGG
TGTTTAGTTTATTCGTGTTGTGTTTAATCCCTAAATTCATCTTTGCTGCATCCACCGGGAGCAAAGTCATGTGCAGGTGACCAAAGCGCTGATGCGTCTG
CTCCATATCCCTCTTGCGTAGCCATATCCATATCCATCACTTCGGTTGCCTTCTCACTTCGCAGCCGATAGATGTTGTCTCGCATCCCAAACTTTAGGAT
AGTGCTTTACGCCGTCTTCTGACCCACTAAGCACATTAGCTTGTAGTTGCCGGTAGTCTGTAGGCATCATATGCTGACCTTGAAGCTCGGCGTGCAGATC
ACTTCATCAGTAAGTCGATCCTCAAGTTCACCAGCTGTTTTGCTAGCAACACGCAGTAGGATAGAGCAACTGAAAGTCGCGAGCTCCGTAGCACCATTAG
CGAAGTCCAACCGGTTCGTCTTGTCTTCAAACAGCGTCGTGAACAGTCAGCCCACCACGAATATTGACCTGCGATCCCGAGTCGAGGATCCACTCCTTAA
AGTTTCCCTCAACATATTCTATGTTCTCGTCGCGACCAACAGCATTCACTGACGCCGTCGGACCTTGGTTGGCACCATCTTGCCTGGGTTGGTCTCATTA
CGGCGACATGCACCTCTACTCTGGCCAGTTGCAGATCCCTGAGCATTGATCTGAGTCGTTCCAGGTCTCTGTGCTTTGGGTTGCTCCTCCCCCTCGGCGC
TCTTCGTCTAGTTGAGGTCCATAGTGCCTCGTCTGGTTCCGACGTGGAGACAACGATGTCCTTCGCATCTGTGTTGCGCTGGCCCGTCATGTCTTGATGG
TCCACAAGGCTCGATATTCCTCGATCTGACACGCAGTGGCGATCGTCCTCTTGGTGACAAGTAATGCGATCCACCACAGTGCCTTGGTGGGAAGCTTTCA
CGTAGTGGAGTCCAACGTGGTTTAGCATGTCCTCGCGGCAGCGAGCGCTCATGGGACGGATATCGCGGAGGTATAGTAGGTCCTCGAGGCGGTGAGCGCT
ACAAGAAGGCGCGCGCCGACGATCTGGCGAACACCCTTGAATGAAGGTCCGCGCAGGGAGAGACCACATTTGGGTGACCTTGGGGGCAGCGCTCTCTCGA
GGTAGCGAACAAGCTTGTAAAGCCGATTAAACATTTATCCGTACTAACTAGGCATAATTAGATTATGCTATAATTGTGGAAATATAAGGCCCGGAAGGCA
GTTTGGCCGCTATGTGGATTCCAGGGGGAAACAAACGTTTTTCATGACAGCTTTTGTACTCTATGAGTCGCCGTTTATCATGGCGTTTCGCGACGTCCCG
TTGTCTTGGCCGTTGAACAACTGGCTGACAAATATGTTATGCATGGCCTAAATTCAATCTCAAGTTATATAACGCGAGTAATCGTCTATAAACACCACAT
ACGTGCAACCACCAGTCGTCTTGGGTCCATTTGGACCCTTCACATTTGTACGCATAAATTCACTGCAACGCCACATATGATGAAAGTGTCCGACTCGAGG
GAAGTCATCCGCTCTCATCTCCCTACGCAGCAGCCTGTACAGACGTCCTCACTCGTGACTTCATCCGTGATGCGACATTCACTTTCTGCCGAGGTCAATT
TTTGTCTTAGCGCTTGGGATGTGAGCTAGACGTGTCTACCATATCTCATACGGCGCCTTACAAGATATTGCAACGTAACACACCTCTCCTCGCCCTCCAC
TGTCTTTAGCTTGTGAATGTTTCTACAGCGCGAGGTATCCATGGTGATAGCGTCACCATAGCGGAAGCCACTCGTGTCCTTTGAACTACACCGTGACGTC
CTTTTCAGCCGGTTTAGACCAGGACATGAGGCTTCTGCCAACGTTAGGCATGTTAAGATCAATCGCCAGCTTCACGAACGATCCATCCTCCATCTTCAAC
CCGACGGCCCCCGTTGCAACTGCGTCGATCTTCGTGCCATCCGCAATCATGATCCGGATAGGCGTTCTCAGGTCCCCATAAACACAATTTTGGCTTGGAT
GCTGGTAATGTGCGTGGGTTTTCGCACGAATCGATGAGCTAATCCGATTTGGCCGTCGCACCCGCAGCCGGCACGCAAAATCGGTAGTTTGAGCTTGCGC
CATGTGCCCACCCCTCGTCAACCTTCTACTTCCAGCATTCAAACTCTTTCACTCACTCGAACCGCCTCTGAATAGCGACGGCTATACCCTTGTTTCTAGC
CGTAGAAGCCCTTGCCATCAAAGCGACGCAGGTTTTTAATGTCTTCTCTATTCGTTACACAAGCTCTCCCTTGAGACAATGGCAATTCATCGTAAGCTTC
AACACCATAGAGCGCTTGAATCGCGTATGTGAGCGTCGCGTTGGGCGTATTCGCGAGGAAGTCGCAAGCTTTCGGCACTCGTCGGTCAAAATTTCTGGGT
TGCGGCACGAGCTGCCCAGTCGCAACCGCAGAATCACCGATTGACCCCCTTTAGACTATCTACCCCTTCTACTTGTCTACATAAGCAACGAGCTTCGTAA
CGGGCTCCACATATATGCTGGGTAACTTTTAAGTAATGAGAAGCCGGTTCTTGAGGGTCTTATTATTGATGTGACGGGGCAACACAGCACCTTGCGCTAG
TGGAAGGCGGCTTCCGAGAGTATACACATTCTCAGTGAACAGCGGTTCACTGGTCCCTTTTGTCGGAGGGAGCGAGGTGACCAATTTAGGGTAAGTTGTA
AGTTGAGCGTA